Review



iscript reverse transcription supermix for rt qpcr  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad iscript reverse transcription supermix for rt qpcr
    ( A ) Gel shows expected bands from flox genotyping using a Yap1Flox:cre system. Adapted from Abraham et al, . ( B ) Gels show the genotype of breeding partners. Note that only males carry the Sox2-cre allele to avoid maternal inheritance of Cre activity. ( C ) Same-day genotyping for flox and Cre for fresh-embryo sequencing was performed from the yolk sacs of 14 embryos, simultaneously isolated from 2 pregnant dams. Four controls, indicated in red triangles, and three Yap1 cKO embryos (floxflox/cre +), shown in blue circles, were pooled and processed for scRNAseq. ( D ) Genotyping of SRY (sex identity) in the 14 embryos isolated for the experimental design of the scRNAseq experiment. ( E ) Violin plot of Yap1 and Wwtr1 (TAZ) from scRNAseq expression levels in all clusters comparing Yap1 cKO to control. Yap1 expression is significantly reduced in Yap1 cKO cells across epiblast lineages, including epiblast (adjusted p = 7.8 × 10⁻⁵⁸), primitive streak (1.2 × 10⁻²⁰), nascent mesoderm (4.2 × 10⁻¹⁷), cardiac mesoderm (1.2 × 10⁻⁵), blood progenitors, and endoderm (3.8 × 10⁻⁴). Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗ p < 0.05, ∗∗ p < 0.001, ∗∗∗ p < 0.0001). Each dot represents a single cell from E7 scRNAseq data. ( F ) Graphs <t>show</t> <t>RT-qPCR</t> analysis of Yap1 and its target gene, Ccn2 (CTGF), in E7.5 Yap1 cKO and control embryos ( n = 10). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0072 and *** p < 0.0008. ( G ) Graphs display cell cycle S and G2M scores in control and Yap1 cKO embryos from scRNAseq analysis. Box-and-whisker plots indicate the median (center line), interquartile range (25th–75th percentiles; box), and minimum to maximum values (whiskers). Individual dots represent a single cell from E7 embryo scRNA-seq data. ( H ) Bright-field images of control and Yap1 cKO E7 embryos. Graphs show cell number quantification per embryo (left) and the size of the epiblast (right) in control and Yap1 cKO embryos ( n = 8–10 embryos). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test. Scale bar 250 µm. ( I ) Single cell pathway analysis was applied to DEGs. Terms related to TGFb and Wnt signaling pathways significantly enriched (q-value > 1.4, adj. p -value < 0.05) in the epiblast are shown. ( J ) Full western blot of nuclear extracts of E7 embryos shown in Fig. . C: control embryos and Y: Yap1 cKO embryos. Red Arrows indicate bands shown in main Figure; SMAD2/3 (mw: 55 kDa), HISTONE H3 (mw: 15 kDa), GAPDH (mw: 37 kDa), Β-CATENIN (mw: 90 kDa). ( K ) Western blot of whole embryo lysates of E7 control and Yap1 cKO embryos. Pooled embryos numbers are indicated above each lane, along with the makers analyzed and on the right is the full blots. Red Arrows indicate bands that were cropped; SMAD2/3 (mw: 55 kDa), GAPDH (mw: 37 kDa), and Β-CATENIN (mw: 90 kDa).
    Iscript Reverse Transcription Supermix For Rt Qpcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 6821 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iscript+reverse+transcription+supermix+rt-qpcr/IScript+C+DNA+Synthesis+Kit/pmc13172546-74-0-7
    Average 99 stars, based on 6821 article reviews
    iscript reverse transcription supermix for rt qpcr - by Bioz Stars, 2026-10
    99/100 stars

    Images

    1) Product Images from "YAP1 and QSER1 are key modulators of embryonic signaling pathways in the mammalian epiblast"

    Article Title: YAP1 and QSER1 are key modulators of embryonic signaling pathways in the mammalian epiblast

    Journal: EMBO Reports

    doi: 10.1038/s44319-026-00746-z

    ( A ) Gel shows expected bands from flox genotyping using a Yap1Flox:cre system. Adapted from Abraham et al, . ( B ) Gels show the genotype of breeding partners. Note that only males carry the Sox2-cre allele to avoid maternal inheritance of Cre activity. ( C ) Same-day genotyping for flox and Cre for fresh-embryo sequencing was performed from the yolk sacs of 14 embryos, simultaneously isolated from 2 pregnant dams. Four controls, indicated in red triangles, and three Yap1 cKO embryos (floxflox/cre +), shown in blue circles, were pooled and processed for scRNAseq. ( D ) Genotyping of SRY (sex identity) in the 14 embryos isolated for the experimental design of the scRNAseq experiment. ( E ) Violin plot of Yap1 and Wwtr1 (TAZ) from scRNAseq expression levels in all clusters comparing Yap1 cKO to control. Yap1 expression is significantly reduced in Yap1 cKO cells across epiblast lineages, including epiblast (adjusted p = 7.8 × 10⁻⁵⁸), primitive streak (1.2 × 10⁻²⁰), nascent mesoderm (4.2 × 10⁻¹⁷), cardiac mesoderm (1.2 × 10⁻⁵), blood progenitors, and endoderm (3.8 × 10⁻⁴). Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗ p < 0.05, ∗∗ p < 0.001, ∗∗∗ p < 0.0001). Each dot represents a single cell from E7 scRNAseq data. ( F ) Graphs show RT-qPCR analysis of Yap1 and its target gene, Ccn2 (CTGF), in E7.5 Yap1 cKO and control embryos ( n = 10). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0072 and *** p < 0.0008. ( G ) Graphs display cell cycle S and G2M scores in control and Yap1 cKO embryos from scRNAseq analysis. Box-and-whisker plots indicate the median (center line), interquartile range (25th–75th percentiles; box), and minimum to maximum values (whiskers). Individual dots represent a single cell from E7 embryo scRNA-seq data. ( H ) Bright-field images of control and Yap1 cKO E7 embryos. Graphs show cell number quantification per embryo (left) and the size of the epiblast (right) in control and Yap1 cKO embryos ( n = 8–10 embryos). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test. Scale bar 250 µm. ( I ) Single cell pathway analysis was applied to DEGs. Terms related to TGFb and Wnt signaling pathways significantly enriched (q-value > 1.4, adj. p -value < 0.05) in the epiblast are shown. ( J ) Full western blot of nuclear extracts of E7 embryos shown in Fig. . C: control embryos and Y: Yap1 cKO embryos. Red Arrows indicate bands shown in main Figure; SMAD2/3 (mw: 55 kDa), HISTONE H3 (mw: 15 kDa), GAPDH (mw: 37 kDa), Β-CATENIN (mw: 90 kDa). ( K ) Western blot of whole embryo lysates of E7 control and Yap1 cKO embryos. Pooled embryos numbers are indicated above each lane, along with the makers analyzed and on the right is the full blots. Red Arrows indicate bands that were cropped; SMAD2/3 (mw: 55 kDa), GAPDH (mw: 37 kDa), and Β-CATENIN (mw: 90 kDa).
    Figure Legend Snippet: ( A ) Gel shows expected bands from flox genotyping using a Yap1Flox:cre system. Adapted from Abraham et al, . ( B ) Gels show the genotype of breeding partners. Note that only males carry the Sox2-cre allele to avoid maternal inheritance of Cre activity. ( C ) Same-day genotyping for flox and Cre for fresh-embryo sequencing was performed from the yolk sacs of 14 embryos, simultaneously isolated from 2 pregnant dams. Four controls, indicated in red triangles, and three Yap1 cKO embryos (floxflox/cre +), shown in blue circles, were pooled and processed for scRNAseq. ( D ) Genotyping of SRY (sex identity) in the 14 embryos isolated for the experimental design of the scRNAseq experiment. ( E ) Violin plot of Yap1 and Wwtr1 (TAZ) from scRNAseq expression levels in all clusters comparing Yap1 cKO to control. Yap1 expression is significantly reduced in Yap1 cKO cells across epiblast lineages, including epiblast (adjusted p = 7.8 × 10⁻⁵⁸), primitive streak (1.2 × 10⁻²⁰), nascent mesoderm (4.2 × 10⁻¹⁷), cardiac mesoderm (1.2 × 10⁻⁵), blood progenitors, and endoderm (3.8 × 10⁻⁴). Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗ p < 0.05, ∗∗ p < 0.001, ∗∗∗ p < 0.0001). Each dot represents a single cell from E7 scRNAseq data. ( F ) Graphs show RT-qPCR analysis of Yap1 and its target gene, Ccn2 (CTGF), in E7.5 Yap1 cKO and control embryos ( n = 10). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0072 and *** p < 0.0008. ( G ) Graphs display cell cycle S and G2M scores in control and Yap1 cKO embryos from scRNAseq analysis. Box-and-whisker plots indicate the median (center line), interquartile range (25th–75th percentiles; box), and minimum to maximum values (whiskers). Individual dots represent a single cell from E7 embryo scRNA-seq data. ( H ) Bright-field images of control and Yap1 cKO E7 embryos. Graphs show cell number quantification per embryo (left) and the size of the epiblast (right) in control and Yap1 cKO embryos ( n = 8–10 embryos). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test. Scale bar 250 µm. ( I ) Single cell pathway analysis was applied to DEGs. Terms related to TGFb and Wnt signaling pathways significantly enriched (q-value > 1.4, adj. p -value < 0.05) in the epiblast are shown. ( J ) Full western blot of nuclear extracts of E7 embryos shown in Fig. . C: control embryos and Y: Yap1 cKO embryos. Red Arrows indicate bands shown in main Figure; SMAD2/3 (mw: 55 kDa), HISTONE H3 (mw: 15 kDa), GAPDH (mw: 37 kDa), Β-CATENIN (mw: 90 kDa). ( K ) Western blot of whole embryo lysates of E7 control and Yap1 cKO embryos. Pooled embryos numbers are indicated above each lane, along with the makers analyzed and on the right is the full blots. Red Arrows indicate bands that were cropped; SMAD2/3 (mw: 55 kDa), GAPDH (mw: 37 kDa), and Β-CATENIN (mw: 90 kDa).

    Techniques Used: Activity Assay, Sequencing, Isolation, Expressing, Control, Single Cell, Quantitative RT-PCR, Whisker Assay, Protein-Protein interactions, Western Blot

    ( A ) Mice scheme shows the breeding strategy to obtain embryos with conditional deletion of Yap1 in the epiblast (Sox2cre). Blue arrowheads indicate LoxP alleles. E7 heterozygous control (Sox2cre:YAPflox/+) and Yap1 cKO (Sox2cre:Yap1flox/flox) embryos were processed for scRNAseq analysis. Bright-field images show representative embryos of the indicated genotype. The number of embryos processed for sequencing is indicated. Scale bar 250 µm. ( B ) Heatmap showing expression of lineage markers used to annotate cell populations in the E7 scRNAseq datasets. On the right, a schematic of an E7 mouse gastrula and a UMAP of E7 scRNAseq showing the detected cell populations with the number of cells in parentheses, color-coded to match the heatmap. ( C ) Dot plot depicts the number of differentially expressed genes (DEGs) in each cluster, with the exact count indicated to the left of each dot. Note that the epiblast cluster contains the highest number of DEGs (abs(Log2FC)>0.25, adj. p -value < 0.05). ( D ) Heatmap shows DEGs in the epiblast of Yap1 cKO versus control embryos. Relevant genes for pluripotency and differentiation are shown. ( E ) Violin plots shows scRNAseq expression levels of indicated genes across clusters in control and Yap1 cKO. The dotted box highlights the epiblast cluster. Yap1 expression is significantly reduced in Yap1 cKO cells across multiple lineages, including epiblast (adjusted p = 7.8 × 10⁻⁵⁸), primitive streak (1.2 × 10⁻²⁰), nascent mesoderm (4.2 × 10⁻¹⁷), cardiac mesoderm (1.2 × 10⁻⁵), and endoderm (3.8 × 10⁻⁴). Epiblast expression of Nodal (adjusted p = 1.0 × 10⁻⁵), Fgf8 (7.1 × 10⁻⁹), Axin2 (4 × 10⁻ 3 ), and Wnt3 (1.5 × 10⁻⁴) is significantly altered in Yap1 cKO embryos. Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗ p < 0.05, ∗∗ p < 0.001, ∗∗∗ p < 0.0001). Each dot represents a single cell from E7 scRNAseq data. ( F ) Graph shows RT-qPCR analysis of the Nodal gene in E7.5 control and Yap1 cKO embryos ( n = 10). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( G ) Single-cell pathway enrichment analysis (SCPA) was performed on DEGs of Yap1 cKO compared to control. The UMAP plot shows the enrichment of two terms related to the Nodal/TGFb and Wnt pathway. Significant q-values (>1.4) are displayed in orange with the names of populations. The complete list of Wnt and TGFb terms enriched are shown in Fig. . ( H ) Western blot of nuclear extracts of E7 control and Yap1 cKO embryos. The number of embryos pooled per lane is indicated above each lane, along with the markers analyzed. Error bars represent mean ± SD. Uncropped blots are found in Fig. .
    Figure Legend Snippet: ( A ) Mice scheme shows the breeding strategy to obtain embryos with conditional deletion of Yap1 in the epiblast (Sox2cre). Blue arrowheads indicate LoxP alleles. E7 heterozygous control (Sox2cre:YAPflox/+) and Yap1 cKO (Sox2cre:Yap1flox/flox) embryos were processed for scRNAseq analysis. Bright-field images show representative embryos of the indicated genotype. The number of embryos processed for sequencing is indicated. Scale bar 250 µm. ( B ) Heatmap showing expression of lineage markers used to annotate cell populations in the E7 scRNAseq datasets. On the right, a schematic of an E7 mouse gastrula and a UMAP of E7 scRNAseq showing the detected cell populations with the number of cells in parentheses, color-coded to match the heatmap. ( C ) Dot plot depicts the number of differentially expressed genes (DEGs) in each cluster, with the exact count indicated to the left of each dot. Note that the epiblast cluster contains the highest number of DEGs (abs(Log2FC)>0.25, adj. p -value < 0.05). ( D ) Heatmap shows DEGs in the epiblast of Yap1 cKO versus control embryos. Relevant genes for pluripotency and differentiation are shown. ( E ) Violin plots shows scRNAseq expression levels of indicated genes across clusters in control and Yap1 cKO. The dotted box highlights the epiblast cluster. Yap1 expression is significantly reduced in Yap1 cKO cells across multiple lineages, including epiblast (adjusted p = 7.8 × 10⁻⁵⁸), primitive streak (1.2 × 10⁻²⁰), nascent mesoderm (4.2 × 10⁻¹⁷), cardiac mesoderm (1.2 × 10⁻⁵), and endoderm (3.8 × 10⁻⁴). Epiblast expression of Nodal (adjusted p = 1.0 × 10⁻⁵), Fgf8 (7.1 × 10⁻⁹), Axin2 (4 × 10⁻ 3 ), and Wnt3 (1.5 × 10⁻⁴) is significantly altered in Yap1 cKO embryos. Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗ p < 0.05, ∗∗ p < 0.001, ∗∗∗ p < 0.0001). Each dot represents a single cell from E7 scRNAseq data. ( F ) Graph shows RT-qPCR analysis of the Nodal gene in E7.5 control and Yap1 cKO embryos ( n = 10). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( G ) Single-cell pathway enrichment analysis (SCPA) was performed on DEGs of Yap1 cKO compared to control. The UMAP plot shows the enrichment of two terms related to the Nodal/TGFb and Wnt pathway. Significant q-values (>1.4) are displayed in orange with the names of populations. The complete list of Wnt and TGFb terms enriched are shown in Fig. . ( H ) Western blot of nuclear extracts of E7 control and Yap1 cKO embryos. The number of embryos pooled per lane is indicated above each lane, along with the markers analyzed. Error bars represent mean ± SD. Uncropped blots are found in Fig. .

    Techniques Used: Control, Sequencing, Expressing, Single Cell, Quantitative RT-PCR, Western Blot

    ( A ) Bar graph showing the percentage of embryonic cell populations detected by scRNA-seq analysis in control and Yap1 cKO embryos. Statistical significance was assessed using the Chi-square test (* p < 0.05). Only embryonic populations are shown. See Fig. for analysis including all populations. ( B ) Representative images of whole-mount immunostaining for the PS marker BRACHYURY (T/BRA) (green) in E7.5 control and Yap1 cKO embryos. DAPI (blue) marks nuclei. On the right, a scheme summarizing results; compared to controls, Yap1 cKO embryos have expanded the PS domain. Scale bar 250 µm Pr: proximal, A: anterior, P: posterior, D: Distal. ( C ) Graphs show quantifications of T/BRA signal intensity along the proximal to distal axis of the embryo (left), the posterior to anterior axis (middle), and the overall intensity of the immunostaining (right). An in-house developed Matlab script was applied to quantify fluorescence. The experiment was replicated with three separate litters ( n = 3). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( D ) RT-qPCR of T/Bra in E7.5 control and Yap1 cKO embryos ( n = 10). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, ∗∗ p = 0.0097.
    Figure Legend Snippet: ( A ) Bar graph showing the percentage of embryonic cell populations detected by scRNA-seq analysis in control and Yap1 cKO embryos. Statistical significance was assessed using the Chi-square test (* p < 0.05). Only embryonic populations are shown. See Fig. for analysis including all populations. ( B ) Representative images of whole-mount immunostaining for the PS marker BRACHYURY (T/BRA) (green) in E7.5 control and Yap1 cKO embryos. DAPI (blue) marks nuclei. On the right, a scheme summarizing results; compared to controls, Yap1 cKO embryos have expanded the PS domain. Scale bar 250 µm Pr: proximal, A: anterior, P: posterior, D: Distal. ( C ) Graphs show quantifications of T/BRA signal intensity along the proximal to distal axis of the embryo (left), the posterior to anterior axis (middle), and the overall intensity of the immunostaining (right). An in-house developed Matlab script was applied to quantify fluorescence. The experiment was replicated with three separate litters ( n = 3). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( D ) RT-qPCR of T/Bra in E7.5 control and Yap1 cKO embryos ( n = 10). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, ∗∗ p = 0.0097.

    Techniques Used: Control, Immunostaining, Marker, Fluorescence, Quantitative RT-PCR

    ( A ) Graph shows QSER1 mRNA levels in hESCs transfected with siRNA control and siRNA against QSER1 for 72 h ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, *** p = 0.001. ( B ) Western blot of QSER1 protein levels, same conditions as in ( A ). ( C ) Graphs show ChIP-qPCR analysis of RNA polymerase II protein on the indicated genomic regions in sicontrol and siQSER1 hESCs. QSER1 BS: QSER1 binding site NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0051 (NODAL), ** p = 0.0031 (CDX2), * p = 0.0116 (OTX2), * p = 0.0343 (SOX13), ** p = 0.0011 (SHB), and ** p = 0.0037 (SMAD2). ( D ) H1 hESCs were transfected with control or QSER1 siRNAs and left untreated or treated with Activin (=mesoderm inductor) for 24 h. Graphs show RT-qPCR analysis of NODAL and WNT3 genes ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, Nodal (* p = 0.0117, ** p = 0.0098, **** p < 0.001) and Wnt (* p = 0.0154, ** p = 0.0012, *** p = 0.0003). ( E ) Representative images of hESCs treated with Activin (50 ng/mL) for 48 h and immunostained for BRACHYURY (BRA). The experimental groups are indicated; sicontrol (scramble siRNA), siQSER1 (siRNA against QSER1) or a YAP1 inhibitor (0.5 µM Dasatinib; YAP1i) were used. Scale bar, 50 µm. ( F ) Graph shows quantification of BRACHYURY immunostaining signal across the indicated experimental groups (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: One-way ANOVA, **** p < 0.0001. ( G ) NODAL protein expression was visualized (live imaging) using an engineered dual-reporter line expressing NODAL-citrine and H2B-RFP (Liu et al, ). H2B-RFP is shown as control. Experimental groups are indicated. BF, bright field. Scale bar, 125 µm. ( H ) Graph shows quantification of intensity of citrine-Nodal levels (cNODAL) per cell (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( I ) UMAP from scRNAseq datasets of E7 embryos showing Qser1 mRNA expression in control and cYap1 KO embryos. Dotted circles highlight the epiblast cluster (see Fig. ). Differential Qser1 expression in the epiblast of Yap1 cKO versus control embryos is indicated (adj. p = 1.93e-07). ( J ) Violin plot of Qser1 from scRNAseq of E7 embryos showing expression levels in all clusters Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗∗∗ p = 1.9e-07). Each dot represents a single cell from E7 scRNAseq data. ( K ) WT H1 hESCs were differentiated toward ectoderm (ecto), mesoderm (meso), or endoderm (endo) fates followed by RNAseq analysis (Stronati et al, ). Graph shows the expression of QSER1 from these datasets in the indicated conditions ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0004 and *** p < 0.001, ** p < 0.01). ( L ) Cooperative mechanism of YAP1 and QSER1 modulating gene expression of signaling genes in the mammalian epiblast. Two developmental stages are shown. QSER1 expression decreases as the epiblast transitions to PS, which allows RNAPII recruitment and increased transcription of genes, including Nodal . PS: primitive streak. Pr: proximal, A: anterior, P: posterior, D: Distal.
    Figure Legend Snippet: ( A ) Graph shows QSER1 mRNA levels in hESCs transfected with siRNA control and siRNA against QSER1 for 72 h ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, *** p = 0.001. ( B ) Western blot of QSER1 protein levels, same conditions as in ( A ). ( C ) Graphs show ChIP-qPCR analysis of RNA polymerase II protein on the indicated genomic regions in sicontrol and siQSER1 hESCs. QSER1 BS: QSER1 binding site NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0051 (NODAL), ** p = 0.0031 (CDX2), * p = 0.0116 (OTX2), * p = 0.0343 (SOX13), ** p = 0.0011 (SHB), and ** p = 0.0037 (SMAD2). ( D ) H1 hESCs were transfected with control or QSER1 siRNAs and left untreated or treated with Activin (=mesoderm inductor) for 24 h. Graphs show RT-qPCR analysis of NODAL and WNT3 genes ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, Nodal (* p = 0.0117, ** p = 0.0098, **** p < 0.001) and Wnt (* p = 0.0154, ** p = 0.0012, *** p = 0.0003). ( E ) Representative images of hESCs treated with Activin (50 ng/mL) for 48 h and immunostained for BRACHYURY (BRA). The experimental groups are indicated; sicontrol (scramble siRNA), siQSER1 (siRNA against QSER1) or a YAP1 inhibitor (0.5 µM Dasatinib; YAP1i) were used. Scale bar, 50 µm. ( F ) Graph shows quantification of BRACHYURY immunostaining signal across the indicated experimental groups (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: One-way ANOVA, **** p < 0.0001. ( G ) NODAL protein expression was visualized (live imaging) using an engineered dual-reporter line expressing NODAL-citrine and H2B-RFP (Liu et al, ). H2B-RFP is shown as control. Experimental groups are indicated. BF, bright field. Scale bar, 125 µm. ( H ) Graph shows quantification of intensity of citrine-Nodal levels (cNODAL) per cell (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( I ) UMAP from scRNAseq datasets of E7 embryos showing Qser1 mRNA expression in control and cYap1 KO embryos. Dotted circles highlight the epiblast cluster (see Fig. ). Differential Qser1 expression in the epiblast of Yap1 cKO versus control embryos is indicated (adj. p = 1.93e-07). ( J ) Violin plot of Qser1 from scRNAseq of E7 embryos showing expression levels in all clusters Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗∗∗ p = 1.9e-07). Each dot represents a single cell from E7 scRNAseq data. ( K ) WT H1 hESCs were differentiated toward ectoderm (ecto), mesoderm (meso), or endoderm (endo) fates followed by RNAseq analysis (Stronati et al, ). Graph shows the expression of QSER1 from these datasets in the indicated conditions ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0004 and *** p < 0.001, ** p < 0.01). ( L ) Cooperative mechanism of YAP1 and QSER1 modulating gene expression of signaling genes in the mammalian epiblast. Two developmental stages are shown. QSER1 expression decreases as the epiblast transitions to PS, which allows RNAPII recruitment and increased transcription of genes, including Nodal . PS: primitive streak. Pr: proximal, A: anterior, P: posterior, D: Distal.

    Techniques Used: Transfection, Control, Western Blot, ChIP-qPCR, Binding Assay, Negative Control, Quantitative RT-PCR, Immunostaining, Expressing, Imaging, Single Cell, RNA sequencing, Gene Expression

    ( A ) IGV genome browser snapshots show more examples of distribution of QSER1, YAP1, TEAD4, and NIPBL on indicated genes. ( B ) Graphs show ChIP-qPCR analysis of QSER1 protein on the indicated genomic regions in WT and YAP1 KO hESCs. QSER1 BS: QSER1 binding site. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( C ) Graphs show ChIP-qPCR analysis of YAP1 protein on the indicated genomic regions and conditions in sicontrol and siQSER1 conditions. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( D ) RT-qPCR of gene expression of CTGF (downstream gene of the Hippo signaling pathway) and NODAL in WT H1 hESCs treated with or without 5 µM GNE-7883 TEAD inhibitor (TEADi) ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0056 (CTGF) and ** p = 0.0059 (NODAL). ( E ) Graph of ChIP-qPCR of TEAD4, YAP1, and QSER1 at enhancer of the NODAL gene in untreated and TEADi treated cells. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, * p = 0.0148, ** p = 0.0064 (YAP1), and ** p = 0.0066 (TEAD4). ( F ) Molecular modeling of TEAD4 (blue), YAP1 (orange), and QSER1 (green) using AlphaFold3 showing that YAP1 residues 50–60 are tightly bound to QSER1 residues 1613–1623 (7 hydrogen bonds) and TEAD4 residues 340–349 (5 hydrogen bonds, shown as dotted lines). Top ipTM scores for this complex are 0.68, reflecting a high confidence in the conformation of this model.
    Figure Legend Snippet: ( A ) IGV genome browser snapshots show more examples of distribution of QSER1, YAP1, TEAD4, and NIPBL on indicated genes. ( B ) Graphs show ChIP-qPCR analysis of QSER1 protein on the indicated genomic regions in WT and YAP1 KO hESCs. QSER1 BS: QSER1 binding site. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( C ) Graphs show ChIP-qPCR analysis of YAP1 protein on the indicated genomic regions and conditions in sicontrol and siQSER1 conditions. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( D ) RT-qPCR of gene expression of CTGF (downstream gene of the Hippo signaling pathway) and NODAL in WT H1 hESCs treated with or without 5 µM GNE-7883 TEAD inhibitor (TEADi) ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0056 (CTGF) and ** p = 0.0059 (NODAL). ( E ) Graph of ChIP-qPCR of TEAD4, YAP1, and QSER1 at enhancer of the NODAL gene in untreated and TEADi treated cells. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, * p = 0.0148, ** p = 0.0064 (YAP1), and ** p = 0.0066 (TEAD4). ( F ) Molecular modeling of TEAD4 (blue), YAP1 (orange), and QSER1 (green) using AlphaFold3 showing that YAP1 residues 50–60 are tightly bound to QSER1 residues 1613–1623 (7 hydrogen bonds) and TEAD4 residues 340–349 (5 hydrogen bonds, shown as dotted lines). Top ipTM scores for this complex are 0.68, reflecting a high confidence in the conformation of this model.

    Techniques Used: ChIP-qPCR, Binding Assay, Negative Control, Quantitative RT-PCR, Gene Expression

    ( A ) Full uncropped blot of Fig. . Blotted against QSER1 (mw: 190 kDa) and beta-TUBLIN (mw: 50 kDa). Red arrow indicates the band that was cropped. Sic: sicontrol and SiQ: siQSER1. ( B ) Graphs show ChIP-qPCR analysis of RNA polymerase II protein on the indicated genomic regions in sicontrol and siQSER1 hESCs. NegC: Negative control region and QSER1 BS: QSER1 binding site ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( C ) Additional images of hESC treated with Activin and stained for BRA shown in Fig. . ( D ) Graphs show RT-qPCR analysis of YAP1-target genes CTGF and CYR61 in hESCs untreated and treated with the YAP1 inhibitor (YAPi) DASATINIB for 72 h treatment ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, CTGF: * p = 0.0367 and CYR61: * p = 0.0490. ( E ) Scheme of the Nodal-citrine: H2B-RFP hESC construct with representative fluorescent images of hESCs under basal conditions. ( F ) Additional images of hESC treated with Activin and NODAL shown in Fig. . ( G ) Representative images of untreated and YAP1i treated hESCs treated with Activin (50 ng/mL) for 48 h, NODAL protein expression was visualized using an engineered dual-reporter line expressing NODAL-citrine and H2B-RFP (Liu et al, ). Scale bar, 125 µm. Graph shows quantification of fluorescence intensity per cell (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0004.
    Figure Legend Snippet: ( A ) Full uncropped blot of Fig. . Blotted against QSER1 (mw: 190 kDa) and beta-TUBLIN (mw: 50 kDa). Red arrow indicates the band that was cropped. Sic: sicontrol and SiQ: siQSER1. ( B ) Graphs show ChIP-qPCR analysis of RNA polymerase II protein on the indicated genomic regions in sicontrol and siQSER1 hESCs. NegC: Negative control region and QSER1 BS: QSER1 binding site ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( C ) Additional images of hESC treated with Activin and stained for BRA shown in Fig. . ( D ) Graphs show RT-qPCR analysis of YAP1-target genes CTGF and CYR61 in hESCs untreated and treated with the YAP1 inhibitor (YAPi) DASATINIB for 72 h treatment ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, CTGF: * p = 0.0367 and CYR61: * p = 0.0490. ( E ) Scheme of the Nodal-citrine: H2B-RFP hESC construct with representative fluorescent images of hESCs under basal conditions. ( F ) Additional images of hESC treated with Activin and NODAL shown in Fig. . ( G ) Representative images of untreated and YAP1i treated hESCs treated with Activin (50 ng/mL) for 48 h, NODAL protein expression was visualized using an engineered dual-reporter line expressing NODAL-citrine and H2B-RFP (Liu et al, ). Scale bar, 125 µm. Graph shows quantification of fluorescence intensity per cell (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0004.

    Techniques Used: ChIP-qPCR, Negative Control, Binding Assay, Staining, Quantitative RT-PCR, Construct, Expressing, Fluorescence

    Related Articles

    Reverse Transcription:

    Article Title: Bezafibrate treatment rescues neurodevelopmental and neurodegenerative defects in 3D cortical organoid model of MAPT frontotemporal dementia
    Article Snippet: All primary and secondary antibodies were diluted in a PBS + 0.1% Tween 20 solution containing 3% BSA (SERVA, Reno, NV, USA). .. Total RNA was extracted with the EZNA Total RNA Kit I (Omega Bio-Tek) and retro-transcribed using the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). .. Real-time RT-PCR was performed with iTaq Universal SYBR Green Supermix (Bio-Rad) on a ViiA 7 Real-Time PCR System (Applied Biosystems).

    Article Title: SLC25A48 controls mitochondrial choline import and metabolism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamic acid potassium salt Sigma-Aldrich Cat# G1501 Succinic acid Sigma-Aldrich Cat# S9512 GDP Sigma-Aldrich Cat# G7127 Oligomycin Cell Signaling Technology Cat# 9996 Carbonyl cyanide-ptrifluoromethoxyphenylhydrazone (FCCP) Sigma-Aldrich Cat# C2920 Rotenone Sigma-Aldrich Cat# 557368 Antimycin A Sigma-Aldrich Cat# A8674 CaCl2 Sigma-Aldrich Cat# C3306 Glucose Sigma-Aldrich Cat# G8270 MgCl2 Sigma-Aldrich Cat# M2393 NaCl Sigma-Aldrich Cat# S7653 Na2HPO4 Fluka Cat# 71639 NaH2PO4 Sigma-Aldrich Cat# 71505 Tris Sigma-Aldrich Cat# 11814273001 EGTA Sigma-Aldrich Cat# E4378 n-dodecyl b-D-maltoside Sigma-Aldrich Cat# D4641 DTT Sigma-Aldrich Cat# 43816 Glycerol Sigma-Aldrich Cat# G7793 D9-Choline Cambridge Isotope Laboratories Cat# DLM-549-PK 3C4,15N2-Riboflavin Cambridge Isotope Laboratories Cat# CNLM-8851-PK PBS Gibco Cat# 10010023 Phenylhydrazone Sigma-Aldrich Cat# C2920 Phosphate buffer solution Thermo Fisher Scientific Cat# P5244 Chloroform Sigma-Aldrich Cat# 650498 Acetonitrile Thermo Fisher Scientific Cat# A955 Methanol Thermo Fisher Scientific Cat# A456 D8-Phe Cambridge Isotope Laboratories Cat# DLM-372-1 D8-Val Cambridge Isotope Laboratories Cat# DLM-7784-PK ammonium hydroxide Thermo Fisher Scientific Cat# 60-023-92 Water LC/MS Thermo Fisher Scientific Cat# W64 SDS Thermo Fisher Scientific Cat# AM9820 EDTA Sigma-Aldrich Cat# E5134 NP-40 Boston Bioproducts Cat# P-877 Deoxycholate Sigma-Aldrich Cat# D6750 Triton-X 100 Thermo Fisher Scientific Cat# BP151 Tween 20 Thermo Fisher Scientific Cat# BP337 KOH Boston Bioproducts Cat# BZ-8038 BSA Sigma-Aldrich Cat# A7906 XF calibrant solution Agilent Cat# 100840-000 CMRL1066 w/L-Glutamine, w/o Choline Chloride, Sodium Acetate USBiological life sciences C5900-07 Glutamax Thermo Fisher Scientific 35050061 Control Crispr/Cas9 plasmid Santa Cruz Biotechnology sc-418922 SLC25A48 Crispr/Cas9 KO plasmid Santa Cruz Biotechnology sc-414730 SLC25A48 HDR plasmid Santa Cruz Biotechnology sc-414730-HDR QuickExtract DNA Extraction Solution 1.0 LGC Biosearch Technologies QE0905T TauI restriction enzyme Thermo Fisher Scientific ER1652 4%PFA Santa Cruz Biotechnology sc-281692 Circular cover glass Electron Microscopy Sciences 72229-01 Choline chloride Sigma Aldrich C7527 (Continued on next page) e2 Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Betaine Sigma Aldrich 61962 3H-Choline Revvity NET109250 13C2-choline Cambridge Isotope Laboratories CLM-548-PK Amplex Red Invitrogen A36006 Horseradish peroxidase (3 U/mL) Thermo Fisher Scientific 31491 Auranofin Sigma Aldrich A6733 SuperBlock Blocking Buffer Thermo Fisher Scientific 37515 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Biorad gels 4-20% Bio-rad Cat# 4561096 Biorad gels 12% 10 well Bio-rad Cat# 4568044 iscript reverse transcription supermix for rt-qPCR Bio-rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-rad Cat# 1725125 XFe24 FluxPak Agilent Cat# 102340-100 Glucometer Abbott Cat# Freestyle Lite Glucose strips Abbott Cat# 70827 MTS Assay Kit Abcam Cat# ab197010 Click-iT Plus EdU Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10632 FxCycle Violet Ready Flow Reagent Thermo Fisher Scientific Cat# R37166 EdU Staining Proliferation Kit (iFluor 488) Abcam ab219801 Malondialdehyde (MDA) Abcam Cat# ab118970 Glass bottom dish VWR 10810-054 MitoSox Red Thermo Fisher Scientific M36008 MitoTracker Green FM Cell Signaling #9074 Deposited data BAT mitochondrial proteomics Verkerke et al.30 PXD043992 Metabolomics This paper ST003264; DOI: https://doi.org/10.21228/ M8QV5X Experimental models: Cell lines Immortalized brown adipocytes Yoneshiro et al.31 N/A SLC25A48-FLAG immortalized brown adipocytes This paper N/A SLC25A48-KO immortalized brown adipocytes This paper N/A SLC25A48-KOSLC25A48-Flag immortalized brown adipocytes This paper N/A SLC25A48-KO 293T This paper N/A SLC25A48-KOSLC25A48-Flag 293T (Rescue) This paper N/A SLC25A48 SNP-KI (rs200164783) This paper N/A Experimental models: Organisms/strains Mouse: C57BL6J mice Jackson Laboratory Cat# 000664 Mouse: SLC25A48-knockout Jackson Laboratory Cat# 051066-JAX Oligonucleotides A full list of qPCR primers in Table S1 This paper N/A Software and algorithms Biorender Biorender https://biorender.com/ Phylogene Sadreyev et al.15 http://genetics.mgh.harvard.edu/phylogene/ Protter Protter https://wlab.ethz.ch/protter/start/ MetaboAnalyst Pathway Analysis MetaboAnalyst https://metaboanalyst.ca/ (Continued on next page) Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER GO Enrichment Analysis GeneOntology http://geneontology.org/ GraphPad Prism 10 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Other Standard Diet Lab Diet Cat# 5008


    Article Title: Loss of symmetric cell division of apical neural progenitors drives DENND5A -related developmental and epileptic encephalopathy
    Article Snippet: .. RNA was extracted from NPCs and lymphocytes using the RNeasy kit (Qiagen) followed by cDNA synthesis using iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). .. RT-qPCR was performed using SsoFast EvaGreen Supermix (Bio-Rad) with primers targeting human DENND5A (F: CTAAAGCCAGGGATGGTGCC; R: TTTCGGCATACATAGCATTCCT) and TBP (F: TGCACAGGAGCCAAGAGTGAA; R: CACATCACAGCTCCCCACCA).

    Article Title: Exploring the role of environmental enrichment and early life adversity on emotional development.
    Article Snippet: Early life adversity has been linked with a higher probability of developing behavioral impairments and environmental manipulation is a strategy that may reduce the negative effects of exposure to adversity in early life.. Here, we focused on exploring the influence of environmental enrichment (EE) as a protective factor in the context of early life adversity.. We hypothesized that 24 hours of maternal deprivation (MD), in the second week of life, could induce anxiety-like behavior alterations and that exposure to EE could induce resilience to these behaviors due to alterations in the serotonergic system.

    Article Title: PAI1 Regulates Cell Morphology and Migration Markers in Trastuzumab-Resistant HER2-Positive Breast Cancer Cells
    Article Snippet: .. RNA isolation was performed using the Qiagen RNAeasy kit following the manufacturer’s guidelines. cDNA synthesis was carried out using Biorad iScript Reverse Transcription Supermix for RT-qPCR. .. PCR was conducted with the iTaq Universal SYBR Green One-Step Kit, and Ct values were measured with the Applied Biosciences ABI 7500 Real-Time Instrument and 7500 Software v1.

    Quantitative RT-PCR:

    Article Title: Bezafibrate treatment rescues neurodevelopmental and neurodegenerative defects in 3D cortical organoid model of MAPT frontotemporal dementia
    Article Snippet: All primary and secondary antibodies were diluted in a PBS + 0.1% Tween 20 solution containing 3% BSA (SERVA, Reno, NV, USA). .. Total RNA was extracted with the EZNA Total RNA Kit I (Omega Bio-Tek) and retro-transcribed using the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). .. Real-time RT-PCR was performed with iTaq Universal SYBR Green Supermix (Bio-Rad) on a ViiA 7 Real-Time PCR System (Applied Biosystems).


    Article Title: Loss of symmetric cell division of apical neural progenitors drives DENND5A -related developmental and epileptic encephalopathy
    Article Snippet: .. RNA was extracted from NPCs and lymphocytes using the RNeasy kit (Qiagen) followed by cDNA synthesis using iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). .. RT-qPCR was performed using SsoFast EvaGreen Supermix (Bio-Rad) with primers targeting human DENND5A (F: CTAAAGCCAGGGATGGTGCC; R: TTTCGGCATACATAGCATTCCT) and TBP (F: TGCACAGGAGCCAAGAGTGAA; R: CACATCACAGCTCCCCACCA).

    Article Title: Exploring the role of environmental enrichment and early life adversity on emotional development.
    Article Snippet: Early life adversity has been linked with a higher probability of developing behavioral impairments and environmental manipulation is a strategy that may reduce the negative effects of exposure to adversity in early life.. Here, we focused on exploring the influence of environmental enrichment (EE) as a protective factor in the context of early life adversity.. We hypothesized that 24 hours of maternal deprivation (MD), in the second week of life, could induce anxiety-like behavior alterations and that exposure to EE could induce resilience to these behaviors due to alterations in the serotonergic system.

    Blocking Assay:

    Article Title: SLC25A48 controls mitochondrial choline import and metabolism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamic acid potassium salt Sigma-Aldrich Cat# G1501 Succinic acid Sigma-Aldrich Cat# S9512 GDP Sigma-Aldrich Cat# G7127 Oligomycin Cell Signaling Technology Cat# 9996 Carbonyl cyanide-ptrifluoromethoxyphenylhydrazone (FCCP) Sigma-Aldrich Cat# C2920 Rotenone Sigma-Aldrich Cat# 557368 Antimycin A Sigma-Aldrich Cat# A8674 CaCl2 Sigma-Aldrich Cat# C3306 Glucose Sigma-Aldrich Cat# G8270 MgCl2 Sigma-Aldrich Cat# M2393 NaCl Sigma-Aldrich Cat# S7653 Na2HPO4 Fluka Cat# 71639 NaH2PO4 Sigma-Aldrich Cat# 71505 Tris Sigma-Aldrich Cat# 11814273001 EGTA Sigma-Aldrich Cat# E4378 n-dodecyl b-D-maltoside Sigma-Aldrich Cat# D4641 DTT Sigma-Aldrich Cat# 43816 Glycerol Sigma-Aldrich Cat# G7793 D9-Choline Cambridge Isotope Laboratories Cat# DLM-549-PK 3C4,15N2-Riboflavin Cambridge Isotope Laboratories Cat# CNLM-8851-PK PBS Gibco Cat# 10010023 Phenylhydrazone Sigma-Aldrich Cat# C2920 Phosphate buffer solution Thermo Fisher Scientific Cat# P5244 Chloroform Sigma-Aldrich Cat# 650498 Acetonitrile Thermo Fisher Scientific Cat# A955 Methanol Thermo Fisher Scientific Cat# A456 D8-Phe Cambridge Isotope Laboratories Cat# DLM-372-1 D8-Val Cambridge Isotope Laboratories Cat# DLM-7784-PK ammonium hydroxide Thermo Fisher Scientific Cat# 60-023-92 Water LC/MS Thermo Fisher Scientific Cat# W64 SDS Thermo Fisher Scientific Cat# AM9820 EDTA Sigma-Aldrich Cat# E5134 NP-40 Boston Bioproducts Cat# P-877 Deoxycholate Sigma-Aldrich Cat# D6750 Triton-X 100 Thermo Fisher Scientific Cat# BP151 Tween 20 Thermo Fisher Scientific Cat# BP337 KOH Boston Bioproducts Cat# BZ-8038 BSA Sigma-Aldrich Cat# A7906 XF calibrant solution Agilent Cat# 100840-000 CMRL1066 w/L-Glutamine, w/o Choline Chloride, Sodium Acetate USBiological life sciences C5900-07 Glutamax Thermo Fisher Scientific 35050061 Control Crispr/Cas9 plasmid Santa Cruz Biotechnology sc-418922 SLC25A48 Crispr/Cas9 KO plasmid Santa Cruz Biotechnology sc-414730 SLC25A48 HDR plasmid Santa Cruz Biotechnology sc-414730-HDR QuickExtract DNA Extraction Solution 1.0 LGC Biosearch Technologies QE0905T TauI restriction enzyme Thermo Fisher Scientific ER1652 4%PFA Santa Cruz Biotechnology sc-281692 Circular cover glass Electron Microscopy Sciences 72229-01 Choline chloride Sigma Aldrich C7527 (Continued on next page) e2 Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Betaine Sigma Aldrich 61962 3H-Choline Revvity NET109250 13C2-choline Cambridge Isotope Laboratories CLM-548-PK Amplex Red Invitrogen A36006 Horseradish peroxidase (3 U/mL) Thermo Fisher Scientific 31491 Auranofin Sigma Aldrich A6733 SuperBlock Blocking Buffer Thermo Fisher Scientific 37515 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Biorad gels 4-20% Bio-rad Cat# 4561096 Biorad gels 12% 10 well Bio-rad Cat# 4568044 iscript reverse transcription supermix for rt-qPCR Bio-rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-rad Cat# 1725125 XFe24 FluxPak Agilent Cat# 102340-100 Glucometer Abbott Cat# Freestyle Lite Glucose strips Abbott Cat# 70827 MTS Assay Kit Abcam Cat# ab197010 Click-iT Plus EdU Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10632 FxCycle Violet Ready Flow Reagent Thermo Fisher Scientific Cat# R37166 EdU Staining Proliferation Kit (iFluor 488) Abcam ab219801 Malondialdehyde (MDA) Abcam Cat# ab118970 Glass bottom dish VWR 10810-054 MitoSox Red Thermo Fisher Scientific M36008 MitoTracker Green FM Cell Signaling #9074 Deposited data BAT mitochondrial proteomics Verkerke et al.30 PXD043992 Metabolomics This paper ST003264; DOI: https://doi.org/10.21228/ M8QV5X Experimental models: Cell lines Immortalized brown adipocytes Yoneshiro et al.31 N/A SLC25A48-FLAG immortalized brown adipocytes This paper N/A SLC25A48-KO immortalized brown adipocytes This paper N/A SLC25A48-KOSLC25A48-Flag immortalized brown adipocytes This paper N/A SLC25A48-KO 293T This paper N/A SLC25A48-KOSLC25A48-Flag 293T (Rescue) This paper N/A SLC25A48 SNP-KI (rs200164783) This paper N/A Experimental models: Organisms/strains Mouse: C57BL6J mice Jackson Laboratory Cat# 000664 Mouse: SLC25A48-knockout Jackson Laboratory Cat# 051066-JAX Oligonucleotides A full list of qPCR primers in Table S1 This paper N/A Software and algorithms Biorender Biorender https://biorender.com/ Phylogene Sadreyev et al.15 http://genetics.mgh.harvard.edu/phylogene/ Protter Protter https://wlab.ethz.ch/protter/start/ MetaboAnalyst Pathway Analysis MetaboAnalyst https://metaboanalyst.ca/ (Continued on next page) Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER GO Enrichment Analysis GeneOntology http://geneontology.org/ GraphPad Prism 10 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Other Standard Diet Lab Diet Cat# 5008

    Bicinchoninic Acid Protein Assay:

    Article Title: SLC25A48 controls mitochondrial choline import and metabolism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamic acid potassium salt Sigma-Aldrich Cat# G1501 Succinic acid Sigma-Aldrich Cat# S9512 GDP Sigma-Aldrich Cat# G7127 Oligomycin Cell Signaling Technology Cat# 9996 Carbonyl cyanide-ptrifluoromethoxyphenylhydrazone (FCCP) Sigma-Aldrich Cat# C2920 Rotenone Sigma-Aldrich Cat# 557368 Antimycin A Sigma-Aldrich Cat# A8674 CaCl2 Sigma-Aldrich Cat# C3306 Glucose Sigma-Aldrich Cat# G8270 MgCl2 Sigma-Aldrich Cat# M2393 NaCl Sigma-Aldrich Cat# S7653 Na2HPO4 Fluka Cat# 71639 NaH2PO4 Sigma-Aldrich Cat# 71505 Tris Sigma-Aldrich Cat# 11814273001 EGTA Sigma-Aldrich Cat# E4378 n-dodecyl b-D-maltoside Sigma-Aldrich Cat# D4641 DTT Sigma-Aldrich Cat# 43816 Glycerol Sigma-Aldrich Cat# G7793 D9-Choline Cambridge Isotope Laboratories Cat# DLM-549-PK 3C4,15N2-Riboflavin Cambridge Isotope Laboratories Cat# CNLM-8851-PK PBS Gibco Cat# 10010023 Phenylhydrazone Sigma-Aldrich Cat# C2920 Phosphate buffer solution Thermo Fisher Scientific Cat# P5244 Chloroform Sigma-Aldrich Cat# 650498 Acetonitrile Thermo Fisher Scientific Cat# A955 Methanol Thermo Fisher Scientific Cat# A456 D8-Phe Cambridge Isotope Laboratories Cat# DLM-372-1 D8-Val Cambridge Isotope Laboratories Cat# DLM-7784-PK ammonium hydroxide Thermo Fisher Scientific Cat# 60-023-92 Water LC/MS Thermo Fisher Scientific Cat# W64 SDS Thermo Fisher Scientific Cat# AM9820 EDTA Sigma-Aldrich Cat# E5134 NP-40 Boston Bioproducts Cat# P-877 Deoxycholate Sigma-Aldrich Cat# D6750 Triton-X 100 Thermo Fisher Scientific Cat# BP151 Tween 20 Thermo Fisher Scientific Cat# BP337 KOH Boston Bioproducts Cat# BZ-8038 BSA Sigma-Aldrich Cat# A7906 XF calibrant solution Agilent Cat# 100840-000 CMRL1066 w/L-Glutamine, w/o Choline Chloride, Sodium Acetate USBiological life sciences C5900-07 Glutamax Thermo Fisher Scientific 35050061 Control Crispr/Cas9 plasmid Santa Cruz Biotechnology sc-418922 SLC25A48 Crispr/Cas9 KO plasmid Santa Cruz Biotechnology sc-414730 SLC25A48 HDR plasmid Santa Cruz Biotechnology sc-414730-HDR QuickExtract DNA Extraction Solution 1.0 LGC Biosearch Technologies QE0905T TauI restriction enzyme Thermo Fisher Scientific ER1652 4%PFA Santa Cruz Biotechnology sc-281692 Circular cover glass Electron Microscopy Sciences 72229-01 Choline chloride Sigma Aldrich C7527 (Continued on next page) e2 Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Betaine Sigma Aldrich 61962 3H-Choline Revvity NET109250 13C2-choline Cambridge Isotope Laboratories CLM-548-PK Amplex Red Invitrogen A36006 Horseradish peroxidase (3 U/mL) Thermo Fisher Scientific 31491 Auranofin Sigma Aldrich A6733 SuperBlock Blocking Buffer Thermo Fisher Scientific 37515 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Biorad gels 4-20% Bio-rad Cat# 4561096 Biorad gels 12% 10 well Bio-rad Cat# 4568044 iscript reverse transcription supermix for rt-qPCR Bio-rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-rad Cat# 1725125 XFe24 FluxPak Agilent Cat# 102340-100 Glucometer Abbott Cat# Freestyle Lite Glucose strips Abbott Cat# 70827 MTS Assay Kit Abcam Cat# ab197010 Click-iT Plus EdU Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10632 FxCycle Violet Ready Flow Reagent Thermo Fisher Scientific Cat# R37166 EdU Staining Proliferation Kit (iFluor 488) Abcam ab219801 Malondialdehyde (MDA) Abcam Cat# ab118970 Glass bottom dish VWR 10810-054 MitoSox Red Thermo Fisher Scientific M36008 MitoTracker Green FM Cell Signaling #9074 Deposited data BAT mitochondrial proteomics Verkerke et al.30 PXD043992 Metabolomics This paper ST003264; DOI: https://doi.org/10.21228/ M8QV5X Experimental models: Cell lines Immortalized brown adipocytes Yoneshiro et al.31 N/A SLC25A48-FLAG immortalized brown adipocytes This paper N/A SLC25A48-KO immortalized brown adipocytes This paper N/A SLC25A48-KOSLC25A48-Flag immortalized brown adipocytes This paper N/A SLC25A48-KO 293T This paper N/A SLC25A48-KOSLC25A48-Flag 293T (Rescue) This paper N/A SLC25A48 SNP-KI (rs200164783) This paper N/A Experimental models: Organisms/strains Mouse: C57BL6J mice Jackson Laboratory Cat# 000664 Mouse: SLC25A48-knockout Jackson Laboratory Cat# 051066-JAX Oligonucleotides A full list of qPCR primers in Table S1 This paper N/A Software and algorithms Biorender Biorender https://biorender.com/ Phylogene Sadreyev et al.15 http://genetics.mgh.harvard.edu/phylogene/ Protter Protter https://wlab.ethz.ch/protter/start/ MetaboAnalyst Pathway Analysis MetaboAnalyst https://metaboanalyst.ca/ (Continued on next page) Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER GO Enrichment Analysis GeneOntology http://geneontology.org/ GraphPad Prism 10 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Other Standard Diet Lab Diet Cat# 5008

    SYBR Green Assay:

    Article Title: SLC25A48 controls mitochondrial choline import and metabolism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamic acid potassium salt Sigma-Aldrich Cat# G1501 Succinic acid Sigma-Aldrich Cat# S9512 GDP Sigma-Aldrich Cat# G7127 Oligomycin Cell Signaling Technology Cat# 9996 Carbonyl cyanide-ptrifluoromethoxyphenylhydrazone (FCCP) Sigma-Aldrich Cat# C2920 Rotenone Sigma-Aldrich Cat# 557368 Antimycin A Sigma-Aldrich Cat# A8674 CaCl2 Sigma-Aldrich Cat# C3306 Glucose Sigma-Aldrich Cat# G8270 MgCl2 Sigma-Aldrich Cat# M2393 NaCl Sigma-Aldrich Cat# S7653 Na2HPO4 Fluka Cat# 71639 NaH2PO4 Sigma-Aldrich Cat# 71505 Tris Sigma-Aldrich Cat# 11814273001 EGTA Sigma-Aldrich Cat# E4378 n-dodecyl b-D-maltoside Sigma-Aldrich Cat# D4641 DTT Sigma-Aldrich Cat# 43816 Glycerol Sigma-Aldrich Cat# G7793 D9-Choline Cambridge Isotope Laboratories Cat# DLM-549-PK 3C4,15N2-Riboflavin Cambridge Isotope Laboratories Cat# CNLM-8851-PK PBS Gibco Cat# 10010023 Phenylhydrazone Sigma-Aldrich Cat# C2920 Phosphate buffer solution Thermo Fisher Scientific Cat# P5244 Chloroform Sigma-Aldrich Cat# 650498 Acetonitrile Thermo Fisher Scientific Cat# A955 Methanol Thermo Fisher Scientific Cat# A456 D8-Phe Cambridge Isotope Laboratories Cat# DLM-372-1 D8-Val Cambridge Isotope Laboratories Cat# DLM-7784-PK ammonium hydroxide Thermo Fisher Scientific Cat# 60-023-92 Water LC/MS Thermo Fisher Scientific Cat# W64 SDS Thermo Fisher Scientific Cat# AM9820 EDTA Sigma-Aldrich Cat# E5134 NP-40 Boston Bioproducts Cat# P-877 Deoxycholate Sigma-Aldrich Cat# D6750 Triton-X 100 Thermo Fisher Scientific Cat# BP151 Tween 20 Thermo Fisher Scientific Cat# BP337 KOH Boston Bioproducts Cat# BZ-8038 BSA Sigma-Aldrich Cat# A7906 XF calibrant solution Agilent Cat# 100840-000 CMRL1066 w/L-Glutamine, w/o Choline Chloride, Sodium Acetate USBiological life sciences C5900-07 Glutamax Thermo Fisher Scientific 35050061 Control Crispr/Cas9 plasmid Santa Cruz Biotechnology sc-418922 SLC25A48 Crispr/Cas9 KO plasmid Santa Cruz Biotechnology sc-414730 SLC25A48 HDR plasmid Santa Cruz Biotechnology sc-414730-HDR QuickExtract DNA Extraction Solution 1.0 LGC Biosearch Technologies QE0905T TauI restriction enzyme Thermo Fisher Scientific ER1652 4%PFA Santa Cruz Biotechnology sc-281692 Circular cover glass Electron Microscopy Sciences 72229-01 Choline chloride Sigma Aldrich C7527 (Continued on next page) e2 Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Betaine Sigma Aldrich 61962 3H-Choline Revvity NET109250 13C2-choline Cambridge Isotope Laboratories CLM-548-PK Amplex Red Invitrogen A36006 Horseradish peroxidase (3 U/mL) Thermo Fisher Scientific 31491 Auranofin Sigma Aldrich A6733 SuperBlock Blocking Buffer Thermo Fisher Scientific 37515 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Biorad gels 4-20% Bio-rad Cat# 4561096 Biorad gels 12% 10 well Bio-rad Cat# 4568044 iscript reverse transcription supermix for rt-qPCR Bio-rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-rad Cat# 1725125 XFe24 FluxPak Agilent Cat# 102340-100 Glucometer Abbott Cat# Freestyle Lite Glucose strips Abbott Cat# 70827 MTS Assay Kit Abcam Cat# ab197010 Click-iT Plus EdU Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10632 FxCycle Violet Ready Flow Reagent Thermo Fisher Scientific Cat# R37166 EdU Staining Proliferation Kit (iFluor 488) Abcam ab219801 Malondialdehyde (MDA) Abcam Cat# ab118970 Glass bottom dish VWR 10810-054 MitoSox Red Thermo Fisher Scientific M36008 MitoTracker Green FM Cell Signaling #9074 Deposited data BAT mitochondrial proteomics Verkerke et al.30 PXD043992 Metabolomics This paper ST003264; DOI: https://doi.org/10.21228/ M8QV5X Experimental models: Cell lines Immortalized brown adipocytes Yoneshiro et al.31 N/A SLC25A48-FLAG immortalized brown adipocytes This paper N/A SLC25A48-KO immortalized brown adipocytes This paper N/A SLC25A48-KOSLC25A48-Flag immortalized brown adipocytes This paper N/A SLC25A48-KO 293T This paper N/A SLC25A48-KOSLC25A48-Flag 293T (Rescue) This paper N/A SLC25A48 SNP-KI (rs200164783) This paper N/A Experimental models: Organisms/strains Mouse: C57BL6J mice Jackson Laboratory Cat# 000664 Mouse: SLC25A48-knockout Jackson Laboratory Cat# 051066-JAX Oligonucleotides A full list of qPCR primers in Table S1 This paper N/A Software and algorithms Biorender Biorender https://biorender.com/ Phylogene Sadreyev et al.15 http://genetics.mgh.harvard.edu/phylogene/ Protter Protter https://wlab.ethz.ch/protter/start/ MetaboAnalyst Pathway Analysis MetaboAnalyst https://metaboanalyst.ca/ (Continued on next page) Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER GO Enrichment Analysis GeneOntology http://geneontology.org/ GraphPad Prism 10 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Other Standard Diet Lab Diet Cat# 5008


    MTS Assay:

    Article Title: SLC25A48 controls mitochondrial choline import and metabolism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamic acid potassium salt Sigma-Aldrich Cat# G1501 Succinic acid Sigma-Aldrich Cat# S9512 GDP Sigma-Aldrich Cat# G7127 Oligomycin Cell Signaling Technology Cat# 9996 Carbonyl cyanide-ptrifluoromethoxyphenylhydrazone (FCCP) Sigma-Aldrich Cat# C2920 Rotenone Sigma-Aldrich Cat# 557368 Antimycin A Sigma-Aldrich Cat# A8674 CaCl2 Sigma-Aldrich Cat# C3306 Glucose Sigma-Aldrich Cat# G8270 MgCl2 Sigma-Aldrich Cat# M2393 NaCl Sigma-Aldrich Cat# S7653 Na2HPO4 Fluka Cat# 71639 NaH2PO4 Sigma-Aldrich Cat# 71505 Tris Sigma-Aldrich Cat# 11814273001 EGTA Sigma-Aldrich Cat# E4378 n-dodecyl b-D-maltoside Sigma-Aldrich Cat# D4641 DTT Sigma-Aldrich Cat# 43816 Glycerol Sigma-Aldrich Cat# G7793 D9-Choline Cambridge Isotope Laboratories Cat# DLM-549-PK 3C4,15N2-Riboflavin Cambridge Isotope Laboratories Cat# CNLM-8851-PK PBS Gibco Cat# 10010023 Phenylhydrazone Sigma-Aldrich Cat# C2920 Phosphate buffer solution Thermo Fisher Scientific Cat# P5244 Chloroform Sigma-Aldrich Cat# 650498 Acetonitrile Thermo Fisher Scientific Cat# A955 Methanol Thermo Fisher Scientific Cat# A456 D8-Phe Cambridge Isotope Laboratories Cat# DLM-372-1 D8-Val Cambridge Isotope Laboratories Cat# DLM-7784-PK ammonium hydroxide Thermo Fisher Scientific Cat# 60-023-92 Water LC/MS Thermo Fisher Scientific Cat# W64 SDS Thermo Fisher Scientific Cat# AM9820 EDTA Sigma-Aldrich Cat# E5134 NP-40 Boston Bioproducts Cat# P-877 Deoxycholate Sigma-Aldrich Cat# D6750 Triton-X 100 Thermo Fisher Scientific Cat# BP151 Tween 20 Thermo Fisher Scientific Cat# BP337 KOH Boston Bioproducts Cat# BZ-8038 BSA Sigma-Aldrich Cat# A7906 XF calibrant solution Agilent Cat# 100840-000 CMRL1066 w/L-Glutamine, w/o Choline Chloride, Sodium Acetate USBiological life sciences C5900-07 Glutamax Thermo Fisher Scientific 35050061 Control Crispr/Cas9 plasmid Santa Cruz Biotechnology sc-418922 SLC25A48 Crispr/Cas9 KO plasmid Santa Cruz Biotechnology sc-414730 SLC25A48 HDR plasmid Santa Cruz Biotechnology sc-414730-HDR QuickExtract DNA Extraction Solution 1.0 LGC Biosearch Technologies QE0905T TauI restriction enzyme Thermo Fisher Scientific ER1652 4%PFA Santa Cruz Biotechnology sc-281692 Circular cover glass Electron Microscopy Sciences 72229-01 Choline chloride Sigma Aldrich C7527 (Continued on next page) e2 Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Betaine Sigma Aldrich 61962 3H-Choline Revvity NET109250 13C2-choline Cambridge Isotope Laboratories CLM-548-PK Amplex Red Invitrogen A36006 Horseradish peroxidase (3 U/mL) Thermo Fisher Scientific 31491 Auranofin Sigma Aldrich A6733 SuperBlock Blocking Buffer Thermo Fisher Scientific 37515 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Biorad gels 4-20% Bio-rad Cat# 4561096 Biorad gels 12% 10 well Bio-rad Cat# 4568044 iscript reverse transcription supermix for rt-qPCR Bio-rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-rad Cat# 1725125 XFe24 FluxPak Agilent Cat# 102340-100 Glucometer Abbott Cat# Freestyle Lite Glucose strips Abbott Cat# 70827 MTS Assay Kit Abcam Cat# ab197010 Click-iT Plus EdU Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10632 FxCycle Violet Ready Flow Reagent Thermo Fisher Scientific Cat# R37166 EdU Staining Proliferation Kit (iFluor 488) Abcam ab219801 Malondialdehyde (MDA) Abcam Cat# ab118970 Glass bottom dish VWR 10810-054 MitoSox Red Thermo Fisher Scientific M36008 MitoTracker Green FM Cell Signaling #9074 Deposited data BAT mitochondrial proteomics Verkerke et al.30 PXD043992 Metabolomics This paper ST003264; DOI: https://doi.org/10.21228/ M8QV5X Experimental models: Cell lines Immortalized brown adipocytes Yoneshiro et al.31 N/A SLC25A48-FLAG immortalized brown adipocytes This paper N/A SLC25A48-KO immortalized brown adipocytes This paper N/A SLC25A48-KOSLC25A48-Flag immortalized brown adipocytes This paper N/A SLC25A48-KO 293T This paper N/A SLC25A48-KOSLC25A48-Flag 293T (Rescue) This paper N/A SLC25A48 SNP-KI (rs200164783) This paper N/A Experimental models: Organisms/strains Mouse: C57BL6J mice Jackson Laboratory Cat# 000664 Mouse: SLC25A48-knockout Jackson Laboratory Cat# 051066-JAX Oligonucleotides A full list of qPCR primers in Table S1 This paper N/A Software and algorithms Biorender Biorender https://biorender.com/ Phylogene Sadreyev et al.15 http://genetics.mgh.harvard.edu/phylogene/ Protter Protter https://wlab.ethz.ch/protter/start/ MetaboAnalyst Pathway Analysis MetaboAnalyst https://metaboanalyst.ca/ (Continued on next page) Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER GO Enrichment Analysis GeneOntology http://geneontology.org/ GraphPad Prism 10 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Other Standard Diet Lab Diet Cat# 5008

    Flow Cytometry:

    Article Title: SLC25A48 controls mitochondrial choline import and metabolism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamic acid potassium salt Sigma-Aldrich Cat# G1501 Succinic acid Sigma-Aldrich Cat# S9512 GDP Sigma-Aldrich Cat# G7127 Oligomycin Cell Signaling Technology Cat# 9996 Carbonyl cyanide-ptrifluoromethoxyphenylhydrazone (FCCP) Sigma-Aldrich Cat# C2920 Rotenone Sigma-Aldrich Cat# 557368 Antimycin A Sigma-Aldrich Cat# A8674 CaCl2 Sigma-Aldrich Cat# C3306 Glucose Sigma-Aldrich Cat# G8270 MgCl2 Sigma-Aldrich Cat# M2393 NaCl Sigma-Aldrich Cat# S7653 Na2HPO4 Fluka Cat# 71639 NaH2PO4 Sigma-Aldrich Cat# 71505 Tris Sigma-Aldrich Cat# 11814273001 EGTA Sigma-Aldrich Cat# E4378 n-dodecyl b-D-maltoside Sigma-Aldrich Cat# D4641 DTT Sigma-Aldrich Cat# 43816 Glycerol Sigma-Aldrich Cat# G7793 D9-Choline Cambridge Isotope Laboratories Cat# DLM-549-PK 3C4,15N2-Riboflavin Cambridge Isotope Laboratories Cat# CNLM-8851-PK PBS Gibco Cat# 10010023 Phenylhydrazone Sigma-Aldrich Cat# C2920 Phosphate buffer solution Thermo Fisher Scientific Cat# P5244 Chloroform Sigma-Aldrich Cat# 650498 Acetonitrile Thermo Fisher Scientific Cat# A955 Methanol Thermo Fisher Scientific Cat# A456 D8-Phe Cambridge Isotope Laboratories Cat# DLM-372-1 D8-Val Cambridge Isotope Laboratories Cat# DLM-7784-PK ammonium hydroxide Thermo Fisher Scientific Cat# 60-023-92 Water LC/MS Thermo Fisher Scientific Cat# W64 SDS Thermo Fisher Scientific Cat# AM9820 EDTA Sigma-Aldrich Cat# E5134 NP-40 Boston Bioproducts Cat# P-877 Deoxycholate Sigma-Aldrich Cat# D6750 Triton-X 100 Thermo Fisher Scientific Cat# BP151 Tween 20 Thermo Fisher Scientific Cat# BP337 KOH Boston Bioproducts Cat# BZ-8038 BSA Sigma-Aldrich Cat# A7906 XF calibrant solution Agilent Cat# 100840-000 CMRL1066 w/L-Glutamine, w/o Choline Chloride, Sodium Acetate USBiological life sciences C5900-07 Glutamax Thermo Fisher Scientific 35050061 Control Crispr/Cas9 plasmid Santa Cruz Biotechnology sc-418922 SLC25A48 Crispr/Cas9 KO plasmid Santa Cruz Biotechnology sc-414730 SLC25A48 HDR plasmid Santa Cruz Biotechnology sc-414730-HDR QuickExtract DNA Extraction Solution 1.0 LGC Biosearch Technologies QE0905T TauI restriction enzyme Thermo Fisher Scientific ER1652 4%PFA Santa Cruz Biotechnology sc-281692 Circular cover glass Electron Microscopy Sciences 72229-01 Choline chloride Sigma Aldrich C7527 (Continued on next page) e2 Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Betaine Sigma Aldrich 61962 3H-Choline Revvity NET109250 13C2-choline Cambridge Isotope Laboratories CLM-548-PK Amplex Red Invitrogen A36006 Horseradish peroxidase (3 U/mL) Thermo Fisher Scientific 31491 Auranofin Sigma Aldrich A6733 SuperBlock Blocking Buffer Thermo Fisher Scientific 37515 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Biorad gels 4-20% Bio-rad Cat# 4561096 Biorad gels 12% 10 well Bio-rad Cat# 4568044 iscript reverse transcription supermix for rt-qPCR Bio-rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-rad Cat# 1725125 XFe24 FluxPak Agilent Cat# 102340-100 Glucometer Abbott Cat# Freestyle Lite Glucose strips Abbott Cat# 70827 MTS Assay Kit Abcam Cat# ab197010 Click-iT Plus EdU Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10632 FxCycle Violet Ready Flow Reagent Thermo Fisher Scientific Cat# R37166 EdU Staining Proliferation Kit (iFluor 488) Abcam ab219801 Malondialdehyde (MDA) Abcam Cat# ab118970 Glass bottom dish VWR 10810-054 MitoSox Red Thermo Fisher Scientific M36008 MitoTracker Green FM Cell Signaling #9074 Deposited data BAT mitochondrial proteomics Verkerke et al.30 PXD043992 Metabolomics This paper ST003264; DOI: https://doi.org/10.21228/ M8QV5X Experimental models: Cell lines Immortalized brown adipocytes Yoneshiro et al.31 N/A SLC25A48-FLAG immortalized brown adipocytes This paper N/A SLC25A48-KO immortalized brown adipocytes This paper N/A SLC25A48-KOSLC25A48-Flag immortalized brown adipocytes This paper N/A SLC25A48-KO 293T This paper N/A SLC25A48-KOSLC25A48-Flag 293T (Rescue) This paper N/A SLC25A48 SNP-KI (rs200164783) This paper N/A Experimental models: Organisms/strains Mouse: C57BL6J mice Jackson Laboratory Cat# 000664 Mouse: SLC25A48-knockout Jackson Laboratory Cat# 051066-JAX Oligonucleotides A full list of qPCR primers in Table S1 This paper N/A Software and algorithms Biorender Biorender https://biorender.com/ Phylogene Sadreyev et al.15 http://genetics.mgh.harvard.edu/phylogene/ Protter Protter https://wlab.ethz.ch/protter/start/ MetaboAnalyst Pathway Analysis MetaboAnalyst https://metaboanalyst.ca/ (Continued on next page) Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER GO Enrichment Analysis GeneOntology http://geneontology.org/ GraphPad Prism 10 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Other Standard Diet Lab Diet Cat# 5008

    Staining:

    Article Title: SLC25A48 controls mitochondrial choline import and metabolism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamic acid potassium salt Sigma-Aldrich Cat# G1501 Succinic acid Sigma-Aldrich Cat# S9512 GDP Sigma-Aldrich Cat# G7127 Oligomycin Cell Signaling Technology Cat# 9996 Carbonyl cyanide-ptrifluoromethoxyphenylhydrazone (FCCP) Sigma-Aldrich Cat# C2920 Rotenone Sigma-Aldrich Cat# 557368 Antimycin A Sigma-Aldrich Cat# A8674 CaCl2 Sigma-Aldrich Cat# C3306 Glucose Sigma-Aldrich Cat# G8270 MgCl2 Sigma-Aldrich Cat# M2393 NaCl Sigma-Aldrich Cat# S7653 Na2HPO4 Fluka Cat# 71639 NaH2PO4 Sigma-Aldrich Cat# 71505 Tris Sigma-Aldrich Cat# 11814273001 EGTA Sigma-Aldrich Cat# E4378 n-dodecyl b-D-maltoside Sigma-Aldrich Cat# D4641 DTT Sigma-Aldrich Cat# 43816 Glycerol Sigma-Aldrich Cat# G7793 D9-Choline Cambridge Isotope Laboratories Cat# DLM-549-PK 3C4,15N2-Riboflavin Cambridge Isotope Laboratories Cat# CNLM-8851-PK PBS Gibco Cat# 10010023 Phenylhydrazone Sigma-Aldrich Cat# C2920 Phosphate buffer solution Thermo Fisher Scientific Cat# P5244 Chloroform Sigma-Aldrich Cat# 650498 Acetonitrile Thermo Fisher Scientific Cat# A955 Methanol Thermo Fisher Scientific Cat# A456 D8-Phe Cambridge Isotope Laboratories Cat# DLM-372-1 D8-Val Cambridge Isotope Laboratories Cat# DLM-7784-PK ammonium hydroxide Thermo Fisher Scientific Cat# 60-023-92 Water LC/MS Thermo Fisher Scientific Cat# W64 SDS Thermo Fisher Scientific Cat# AM9820 EDTA Sigma-Aldrich Cat# E5134 NP-40 Boston Bioproducts Cat# P-877 Deoxycholate Sigma-Aldrich Cat# D6750 Triton-X 100 Thermo Fisher Scientific Cat# BP151 Tween 20 Thermo Fisher Scientific Cat# BP337 KOH Boston Bioproducts Cat# BZ-8038 BSA Sigma-Aldrich Cat# A7906 XF calibrant solution Agilent Cat# 100840-000 CMRL1066 w/L-Glutamine, w/o Choline Chloride, Sodium Acetate USBiological life sciences C5900-07 Glutamax Thermo Fisher Scientific 35050061 Control Crispr/Cas9 plasmid Santa Cruz Biotechnology sc-418922 SLC25A48 Crispr/Cas9 KO plasmid Santa Cruz Biotechnology sc-414730 SLC25A48 HDR plasmid Santa Cruz Biotechnology sc-414730-HDR QuickExtract DNA Extraction Solution 1.0 LGC Biosearch Technologies QE0905T TauI restriction enzyme Thermo Fisher Scientific ER1652 4%PFA Santa Cruz Biotechnology sc-281692 Circular cover glass Electron Microscopy Sciences 72229-01 Choline chloride Sigma Aldrich C7527 (Continued on next page) e2 Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Betaine Sigma Aldrich 61962 3H-Choline Revvity NET109250 13C2-choline Cambridge Isotope Laboratories CLM-548-PK Amplex Red Invitrogen A36006 Horseradish peroxidase (3 U/mL) Thermo Fisher Scientific 31491 Auranofin Sigma Aldrich A6733 SuperBlock Blocking Buffer Thermo Fisher Scientific 37515 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Biorad gels 4-20% Bio-rad Cat# 4561096 Biorad gels 12% 10 well Bio-rad Cat# 4568044 iscript reverse transcription supermix for rt-qPCR Bio-rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-rad Cat# 1725125 XFe24 FluxPak Agilent Cat# 102340-100 Glucometer Abbott Cat# Freestyle Lite Glucose strips Abbott Cat# 70827 MTS Assay Kit Abcam Cat# ab197010 Click-iT Plus EdU Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10632 FxCycle Violet Ready Flow Reagent Thermo Fisher Scientific Cat# R37166 EdU Staining Proliferation Kit (iFluor 488) Abcam ab219801 Malondialdehyde (MDA) Abcam Cat# ab118970 Glass bottom dish VWR 10810-054 MitoSox Red Thermo Fisher Scientific M36008 MitoTracker Green FM Cell Signaling #9074 Deposited data BAT mitochondrial proteomics Verkerke et al.30 PXD043992 Metabolomics This paper ST003264; DOI: https://doi.org/10.21228/ M8QV5X Experimental models: Cell lines Immortalized brown adipocytes Yoneshiro et al.31 N/A SLC25A48-FLAG immortalized brown adipocytes This paper N/A SLC25A48-KO immortalized brown adipocytes This paper N/A SLC25A48-KOSLC25A48-Flag immortalized brown adipocytes This paper N/A SLC25A48-KO 293T This paper N/A SLC25A48-KOSLC25A48-Flag 293T (Rescue) This paper N/A SLC25A48 SNP-KI (rs200164783) This paper N/A Experimental models: Organisms/strains Mouse: C57BL6J mice Jackson Laboratory Cat# 000664 Mouse: SLC25A48-knockout Jackson Laboratory Cat# 051066-JAX Oligonucleotides A full list of qPCR primers in Table S1 This paper N/A Software and algorithms Biorender Biorender https://biorender.com/ Phylogene Sadreyev et al.15 http://genetics.mgh.harvard.edu/phylogene/ Protter Protter https://wlab.ethz.ch/protter/start/ MetaboAnalyst Pathway Analysis MetaboAnalyst https://metaboanalyst.ca/ (Continued on next page) Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER GO Enrichment Analysis GeneOntology http://geneontology.org/ GraphPad Prism 10 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Other Standard Diet Lab Diet Cat# 5008

    Multiple Displacement Amplification:

    Article Title: SLC25A48 controls mitochondrial choline import and metabolism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamic acid potassium salt Sigma-Aldrich Cat# G1501 Succinic acid Sigma-Aldrich Cat# S9512 GDP Sigma-Aldrich Cat# G7127 Oligomycin Cell Signaling Technology Cat# 9996 Carbonyl cyanide-ptrifluoromethoxyphenylhydrazone (FCCP) Sigma-Aldrich Cat# C2920 Rotenone Sigma-Aldrich Cat# 557368 Antimycin A Sigma-Aldrich Cat# A8674 CaCl2 Sigma-Aldrich Cat# C3306 Glucose Sigma-Aldrich Cat# G8270 MgCl2 Sigma-Aldrich Cat# M2393 NaCl Sigma-Aldrich Cat# S7653 Na2HPO4 Fluka Cat# 71639 NaH2PO4 Sigma-Aldrich Cat# 71505 Tris Sigma-Aldrich Cat# 11814273001 EGTA Sigma-Aldrich Cat# E4378 n-dodecyl b-D-maltoside Sigma-Aldrich Cat# D4641 DTT Sigma-Aldrich Cat# 43816 Glycerol Sigma-Aldrich Cat# G7793 D9-Choline Cambridge Isotope Laboratories Cat# DLM-549-PK 3C4,15N2-Riboflavin Cambridge Isotope Laboratories Cat# CNLM-8851-PK PBS Gibco Cat# 10010023 Phenylhydrazone Sigma-Aldrich Cat# C2920 Phosphate buffer solution Thermo Fisher Scientific Cat# P5244 Chloroform Sigma-Aldrich Cat# 650498 Acetonitrile Thermo Fisher Scientific Cat# A955 Methanol Thermo Fisher Scientific Cat# A456 D8-Phe Cambridge Isotope Laboratories Cat# DLM-372-1 D8-Val Cambridge Isotope Laboratories Cat# DLM-7784-PK ammonium hydroxide Thermo Fisher Scientific Cat# 60-023-92 Water LC/MS Thermo Fisher Scientific Cat# W64 SDS Thermo Fisher Scientific Cat# AM9820 EDTA Sigma-Aldrich Cat# E5134 NP-40 Boston Bioproducts Cat# P-877 Deoxycholate Sigma-Aldrich Cat# D6750 Triton-X 100 Thermo Fisher Scientific Cat# BP151 Tween 20 Thermo Fisher Scientific Cat# BP337 KOH Boston Bioproducts Cat# BZ-8038 BSA Sigma-Aldrich Cat# A7906 XF calibrant solution Agilent Cat# 100840-000 CMRL1066 w/L-Glutamine, w/o Choline Chloride, Sodium Acetate USBiological life sciences C5900-07 Glutamax Thermo Fisher Scientific 35050061 Control Crispr/Cas9 plasmid Santa Cruz Biotechnology sc-418922 SLC25A48 Crispr/Cas9 KO plasmid Santa Cruz Biotechnology sc-414730 SLC25A48 HDR plasmid Santa Cruz Biotechnology sc-414730-HDR QuickExtract DNA Extraction Solution 1.0 LGC Biosearch Technologies QE0905T TauI restriction enzyme Thermo Fisher Scientific ER1652 4%PFA Santa Cruz Biotechnology sc-281692 Circular cover glass Electron Microscopy Sciences 72229-01 Choline chloride Sigma Aldrich C7527 (Continued on next page) e2 Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Betaine Sigma Aldrich 61962 3H-Choline Revvity NET109250 13C2-choline Cambridge Isotope Laboratories CLM-548-PK Amplex Red Invitrogen A36006 Horseradish peroxidase (3 U/mL) Thermo Fisher Scientific 31491 Auranofin Sigma Aldrich A6733 SuperBlock Blocking Buffer Thermo Fisher Scientific 37515 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Biorad gels 4-20% Bio-rad Cat# 4561096 Biorad gels 12% 10 well Bio-rad Cat# 4568044 iscript reverse transcription supermix for rt-qPCR Bio-rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-rad Cat# 1725125 XFe24 FluxPak Agilent Cat# 102340-100 Glucometer Abbott Cat# Freestyle Lite Glucose strips Abbott Cat# 70827 MTS Assay Kit Abcam Cat# ab197010 Click-iT Plus EdU Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10632 FxCycle Violet Ready Flow Reagent Thermo Fisher Scientific Cat# R37166 EdU Staining Proliferation Kit (iFluor 488) Abcam ab219801 Malondialdehyde (MDA) Abcam Cat# ab118970 Glass bottom dish VWR 10810-054 MitoSox Red Thermo Fisher Scientific M36008 MitoTracker Green FM Cell Signaling #9074 Deposited data BAT mitochondrial proteomics Verkerke et al.30 PXD043992 Metabolomics This paper ST003264; DOI: https://doi.org/10.21228/ M8QV5X Experimental models: Cell lines Immortalized brown adipocytes Yoneshiro et al.31 N/A SLC25A48-FLAG immortalized brown adipocytes This paper N/A SLC25A48-KO immortalized brown adipocytes This paper N/A SLC25A48-KOSLC25A48-Flag immortalized brown adipocytes This paper N/A SLC25A48-KO 293T This paper N/A SLC25A48-KOSLC25A48-Flag 293T (Rescue) This paper N/A SLC25A48 SNP-KI (rs200164783) This paper N/A Experimental models: Organisms/strains Mouse: C57BL6J mice Jackson Laboratory Cat# 000664 Mouse: SLC25A48-knockout Jackson Laboratory Cat# 051066-JAX Oligonucleotides A full list of qPCR primers in Table S1 This paper N/A Software and algorithms Biorender Biorender https://biorender.com/ Phylogene Sadreyev et al.15 http://genetics.mgh.harvard.edu/phylogene/ Protter Protter https://wlab.ethz.ch/protter/start/ MetaboAnalyst Pathway Analysis MetaboAnalyst https://metaboanalyst.ca/ (Continued on next page) Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER GO Enrichment Analysis GeneOntology http://geneontology.org/ GraphPad Prism 10 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Other Standard Diet Lab Diet Cat# 5008

    Real-time Polymerase Chain Reaction:

    Article Title: SLC25A48 controls mitochondrial choline import and metabolism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamic acid potassium salt Sigma-Aldrich Cat# G1501 Succinic acid Sigma-Aldrich Cat# S9512 GDP Sigma-Aldrich Cat# G7127 Oligomycin Cell Signaling Technology Cat# 9996 Carbonyl cyanide-ptrifluoromethoxyphenylhydrazone (FCCP) Sigma-Aldrich Cat# C2920 Rotenone Sigma-Aldrich Cat# 557368 Antimycin A Sigma-Aldrich Cat# A8674 CaCl2 Sigma-Aldrich Cat# C3306 Glucose Sigma-Aldrich Cat# G8270 MgCl2 Sigma-Aldrich Cat# M2393 NaCl Sigma-Aldrich Cat# S7653 Na2HPO4 Fluka Cat# 71639 NaH2PO4 Sigma-Aldrich Cat# 71505 Tris Sigma-Aldrich Cat# 11814273001 EGTA Sigma-Aldrich Cat# E4378 n-dodecyl b-D-maltoside Sigma-Aldrich Cat# D4641 DTT Sigma-Aldrich Cat# 43816 Glycerol Sigma-Aldrich Cat# G7793 D9-Choline Cambridge Isotope Laboratories Cat# DLM-549-PK 3C4,15N2-Riboflavin Cambridge Isotope Laboratories Cat# CNLM-8851-PK PBS Gibco Cat# 10010023 Phenylhydrazone Sigma-Aldrich Cat# C2920 Phosphate buffer solution Thermo Fisher Scientific Cat# P5244 Chloroform Sigma-Aldrich Cat# 650498 Acetonitrile Thermo Fisher Scientific Cat# A955 Methanol Thermo Fisher Scientific Cat# A456 D8-Phe Cambridge Isotope Laboratories Cat# DLM-372-1 D8-Val Cambridge Isotope Laboratories Cat# DLM-7784-PK ammonium hydroxide Thermo Fisher Scientific Cat# 60-023-92 Water LC/MS Thermo Fisher Scientific Cat# W64 SDS Thermo Fisher Scientific Cat# AM9820 EDTA Sigma-Aldrich Cat# E5134 NP-40 Boston Bioproducts Cat# P-877 Deoxycholate Sigma-Aldrich Cat# D6750 Triton-X 100 Thermo Fisher Scientific Cat# BP151 Tween 20 Thermo Fisher Scientific Cat# BP337 KOH Boston Bioproducts Cat# BZ-8038 BSA Sigma-Aldrich Cat# A7906 XF calibrant solution Agilent Cat# 100840-000 CMRL1066 w/L-Glutamine, w/o Choline Chloride, Sodium Acetate USBiological life sciences C5900-07 Glutamax Thermo Fisher Scientific 35050061 Control Crispr/Cas9 plasmid Santa Cruz Biotechnology sc-418922 SLC25A48 Crispr/Cas9 KO plasmid Santa Cruz Biotechnology sc-414730 SLC25A48 HDR plasmid Santa Cruz Biotechnology sc-414730-HDR QuickExtract DNA Extraction Solution 1.0 LGC Biosearch Technologies QE0905T TauI restriction enzyme Thermo Fisher Scientific ER1652 4%PFA Santa Cruz Biotechnology sc-281692 Circular cover glass Electron Microscopy Sciences 72229-01 Choline chloride Sigma Aldrich C7527 (Continued on next page) e2 Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Betaine Sigma Aldrich 61962 3H-Choline Revvity NET109250 13C2-choline Cambridge Isotope Laboratories CLM-548-PK Amplex Red Invitrogen A36006 Horseradish peroxidase (3 U/mL) Thermo Fisher Scientific 31491 Auranofin Sigma Aldrich A6733 SuperBlock Blocking Buffer Thermo Fisher Scientific 37515 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Biorad gels 4-20% Bio-rad Cat# 4561096 Biorad gels 12% 10 well Bio-rad Cat# 4568044 iscript reverse transcription supermix for rt-qPCR Bio-rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-rad Cat# 1725125 XFe24 FluxPak Agilent Cat# 102340-100 Glucometer Abbott Cat# Freestyle Lite Glucose strips Abbott Cat# 70827 MTS Assay Kit Abcam Cat# ab197010 Click-iT Plus EdU Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10632 FxCycle Violet Ready Flow Reagent Thermo Fisher Scientific Cat# R37166 EdU Staining Proliferation Kit (iFluor 488) Abcam ab219801 Malondialdehyde (MDA) Abcam Cat# ab118970 Glass bottom dish VWR 10810-054 MitoSox Red Thermo Fisher Scientific M36008 MitoTracker Green FM Cell Signaling #9074 Deposited data BAT mitochondrial proteomics Verkerke et al.30 PXD043992 Metabolomics This paper ST003264; DOI: https://doi.org/10.21228/ M8QV5X Experimental models: Cell lines Immortalized brown adipocytes Yoneshiro et al.31 N/A SLC25A48-FLAG immortalized brown adipocytes This paper N/A SLC25A48-KO immortalized brown adipocytes This paper N/A SLC25A48-KOSLC25A48-Flag immortalized brown adipocytes This paper N/A SLC25A48-KO 293T This paper N/A SLC25A48-KOSLC25A48-Flag 293T (Rescue) This paper N/A SLC25A48 SNP-KI (rs200164783) This paper N/A Experimental models: Organisms/strains Mouse: C57BL6J mice Jackson Laboratory Cat# 000664 Mouse: SLC25A48-knockout Jackson Laboratory Cat# 051066-JAX Oligonucleotides A full list of qPCR primers in Table S1 This paper N/A Software and algorithms Biorender Biorender https://biorender.com/ Phylogene Sadreyev et al.15 http://genetics.mgh.harvard.edu/phylogene/ Protter Protter https://wlab.ethz.ch/protter/start/ MetaboAnalyst Pathway Analysis MetaboAnalyst https://metaboanalyst.ca/ (Continued on next page) Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER GO Enrichment Analysis GeneOntology http://geneontology.org/ GraphPad Prism 10 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Other Standard Diet Lab Diet Cat# 5008


    Software:

    Article Title: SLC25A48 controls mitochondrial choline import and metabolism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamic acid potassium salt Sigma-Aldrich Cat# G1501 Succinic acid Sigma-Aldrich Cat# S9512 GDP Sigma-Aldrich Cat# G7127 Oligomycin Cell Signaling Technology Cat# 9996 Carbonyl cyanide-ptrifluoromethoxyphenylhydrazone (FCCP) Sigma-Aldrich Cat# C2920 Rotenone Sigma-Aldrich Cat# 557368 Antimycin A Sigma-Aldrich Cat# A8674 CaCl2 Sigma-Aldrich Cat# C3306 Glucose Sigma-Aldrich Cat# G8270 MgCl2 Sigma-Aldrich Cat# M2393 NaCl Sigma-Aldrich Cat# S7653 Na2HPO4 Fluka Cat# 71639 NaH2PO4 Sigma-Aldrich Cat# 71505 Tris Sigma-Aldrich Cat# 11814273001 EGTA Sigma-Aldrich Cat# E4378 n-dodecyl b-D-maltoside Sigma-Aldrich Cat# D4641 DTT Sigma-Aldrich Cat# 43816 Glycerol Sigma-Aldrich Cat# G7793 D9-Choline Cambridge Isotope Laboratories Cat# DLM-549-PK 3C4,15N2-Riboflavin Cambridge Isotope Laboratories Cat# CNLM-8851-PK PBS Gibco Cat# 10010023 Phenylhydrazone Sigma-Aldrich Cat# C2920 Phosphate buffer solution Thermo Fisher Scientific Cat# P5244 Chloroform Sigma-Aldrich Cat# 650498 Acetonitrile Thermo Fisher Scientific Cat# A955 Methanol Thermo Fisher Scientific Cat# A456 D8-Phe Cambridge Isotope Laboratories Cat# DLM-372-1 D8-Val Cambridge Isotope Laboratories Cat# DLM-7784-PK ammonium hydroxide Thermo Fisher Scientific Cat# 60-023-92 Water LC/MS Thermo Fisher Scientific Cat# W64 SDS Thermo Fisher Scientific Cat# AM9820 EDTA Sigma-Aldrich Cat# E5134 NP-40 Boston Bioproducts Cat# P-877 Deoxycholate Sigma-Aldrich Cat# D6750 Triton-X 100 Thermo Fisher Scientific Cat# BP151 Tween 20 Thermo Fisher Scientific Cat# BP337 KOH Boston Bioproducts Cat# BZ-8038 BSA Sigma-Aldrich Cat# A7906 XF calibrant solution Agilent Cat# 100840-000 CMRL1066 w/L-Glutamine, w/o Choline Chloride, Sodium Acetate USBiological life sciences C5900-07 Glutamax Thermo Fisher Scientific 35050061 Control Crispr/Cas9 plasmid Santa Cruz Biotechnology sc-418922 SLC25A48 Crispr/Cas9 KO plasmid Santa Cruz Biotechnology sc-414730 SLC25A48 HDR plasmid Santa Cruz Biotechnology sc-414730-HDR QuickExtract DNA Extraction Solution 1.0 LGC Biosearch Technologies QE0905T TauI restriction enzyme Thermo Fisher Scientific ER1652 4%PFA Santa Cruz Biotechnology sc-281692 Circular cover glass Electron Microscopy Sciences 72229-01 Choline chloride Sigma Aldrich C7527 (Continued on next page) e2 Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Betaine Sigma Aldrich 61962 3H-Choline Revvity NET109250 13C2-choline Cambridge Isotope Laboratories CLM-548-PK Amplex Red Invitrogen A36006 Horseradish peroxidase (3 U/mL) Thermo Fisher Scientific 31491 Auranofin Sigma Aldrich A6733 SuperBlock Blocking Buffer Thermo Fisher Scientific 37515 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Biorad gels 4-20% Bio-rad Cat# 4561096 Biorad gels 12% 10 well Bio-rad Cat# 4568044 iscript reverse transcription supermix for rt-qPCR Bio-rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-rad Cat# 1725125 XFe24 FluxPak Agilent Cat# 102340-100 Glucometer Abbott Cat# Freestyle Lite Glucose strips Abbott Cat# 70827 MTS Assay Kit Abcam Cat# ab197010 Click-iT Plus EdU Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10632 FxCycle Violet Ready Flow Reagent Thermo Fisher Scientific Cat# R37166 EdU Staining Proliferation Kit (iFluor 488) Abcam ab219801 Malondialdehyde (MDA) Abcam Cat# ab118970 Glass bottom dish VWR 10810-054 MitoSox Red Thermo Fisher Scientific M36008 MitoTracker Green FM Cell Signaling #9074 Deposited data BAT mitochondrial proteomics Verkerke et al.30 PXD043992 Metabolomics This paper ST003264; DOI: https://doi.org/10.21228/ M8QV5X Experimental models: Cell lines Immortalized brown adipocytes Yoneshiro et al.31 N/A SLC25A48-FLAG immortalized brown adipocytes This paper N/A SLC25A48-KO immortalized brown adipocytes This paper N/A SLC25A48-KOSLC25A48-Flag immortalized brown adipocytes This paper N/A SLC25A48-KO 293T This paper N/A SLC25A48-KOSLC25A48-Flag 293T (Rescue) This paper N/A SLC25A48 SNP-KI (rs200164783) This paper N/A Experimental models: Organisms/strains Mouse: C57BL6J mice Jackson Laboratory Cat# 000664 Mouse: SLC25A48-knockout Jackson Laboratory Cat# 051066-JAX Oligonucleotides A full list of qPCR primers in Table S1 This paper N/A Software and algorithms Biorender Biorender https://biorender.com/ Phylogene Sadreyev et al.15 http://genetics.mgh.harvard.edu/phylogene/ Protter Protter https://wlab.ethz.ch/protter/start/ MetaboAnalyst Pathway Analysis MetaboAnalyst https://metaboanalyst.ca/ (Continued on next page) Cell Metabolism 36, 2156–2166.e1–e9, September 3, 2024 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER GO Enrichment Analysis GeneOntology http://geneontology.org/ GraphPad Prism 10 GraphPad Software https://www.graphpad.com/scientific- software/prism/ Other Standard Diet Lab Diet Cat# 5008

    other:

    Article Title: Overcoming Vemurafenib Resistance in Metastatic Melanoma: Targeting Integrins to Improve Treatment Efficacy
    Article Snippet: The Biorad-iScript-Reverse Transcription Supermix for RT-qPCR was used for the cDNA synthesis.

    Article Title: CPT2 Deficiency Modeled in Zebrafish: Abnormal Neural Development, Electrical Activity, Behavior, and Schizophrenia-Related Gene Expression
    Article Snippet: iScript Reverse Transcription Supermix for RT-qPCR , Bio-Rad (Bio-Rad Laboratories, CA, USA) , 1708841.

    Lysis:


    Protease Inhibitor:


    CRISPR:


    Recombinant:


    Plasmid Preparation:


    cDNA Synthesis:

    Article Title: Loss of symmetric cell division of apical neural progenitors drives DENND5A -related developmental and epileptic encephalopathy
    Article Snippet: .. RNA was extracted from NPCs and lymphocytes using the RNeasy kit (Qiagen) followed by cDNA synthesis using iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). .. RT-qPCR was performed using SsoFast EvaGreen Supermix (Bio-Rad) with primers targeting human DENND5A (F: CTAAAGCCAGGGATGGTGCC; R: TTTCGGCATACATAGCATTCCT) and TBP (F: TGCACAGGAGCCAAGAGTGAA; R: CACATCACAGCTCCCCACCA).

    Article Title: Exploring the role of environmental enrichment and early life adversity on emotional development.
    Article Snippet: Early life adversity has been linked with a higher probability of developing behavioral impairments and environmental manipulation is a strategy that may reduce the negative effects of exposure to adversity in early life.. Here, we focused on exploring the influence of environmental enrichment (EE) as a protective factor in the context of early life adversity.. We hypothesized that 24 hours of maternal deprivation (MD), in the second week of life, could induce anxiety-like behavior alterations and that exposure to EE could induce resilience to these behaviors due to alterations in the serotonergic system.

    Article Title: PAI1 Regulates Cell Morphology and Migration Markers in Trastuzumab-Resistant HER2-Positive Breast Cancer Cells
    Article Snippet: .. RNA isolation was performed using the Qiagen RNAeasy kit following the manufacturer’s guidelines. cDNA synthesis was carried out using Biorad iScript Reverse Transcription Supermix for RT-qPCR. .. PCR was conducted with the iTaq Universal SYBR Green One-Step Kit, and Ct values were measured with the Applied Biosciences ABI 7500 Real-Time Instrument and 7500 Software v1.

    Isolation:

    Article Title: PAI1 Regulates Cell Morphology and Migration Markers in Trastuzumab-Resistant HER2-Positive Breast Cancer Cells
    Article Snippet: .. RNA isolation was performed using the Qiagen RNAeasy kit following the manufacturer’s guidelines. cDNA synthesis was carried out using Biorad iScript Reverse Transcription Supermix for RT-qPCR. .. PCR was conducted with the iTaq Universal SYBR Green One-Step Kit, and Ct values were measured with the Applied Biosciences ABI 7500 Real-Time Instrument and 7500 Software v1.



    Similar Products

    99
    Bio-Rad iscript reverse transcription supermix for rt qpcr
    ( A ) Gel shows expected bands from flox genotyping using a Yap1Flox:cre system. Adapted from Abraham et al, . ( B ) Gels show the genotype of breeding partners. Note that only males carry the Sox2-cre allele to avoid maternal inheritance of Cre activity. ( C ) Same-day genotyping for flox and Cre for fresh-embryo sequencing was performed from the yolk sacs of 14 embryos, simultaneously isolated from 2 pregnant dams. Four controls, indicated in red triangles, and three Yap1 cKO embryos (floxflox/cre +), shown in blue circles, were pooled and processed for scRNAseq. ( D ) Genotyping of SRY (sex identity) in the 14 embryos isolated for the experimental design of the scRNAseq experiment. ( E ) Violin plot of Yap1 and Wwtr1 (TAZ) from scRNAseq expression levels in all clusters comparing Yap1 cKO to control. Yap1 expression is significantly reduced in Yap1 cKO cells across epiblast lineages, including epiblast (adjusted p = 7.8 × 10⁻⁵⁸), primitive streak (1.2 × 10⁻²⁰), nascent mesoderm (4.2 × 10⁻¹⁷), cardiac mesoderm (1.2 × 10⁻⁵), blood progenitors, and endoderm (3.8 × 10⁻⁴). Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗ p < 0.05, ∗∗ p < 0.001, ∗∗∗ p < 0.0001). Each dot represents a single cell from E7 scRNAseq data. ( F ) Graphs <t>show</t> <t>RT-qPCR</t> analysis of Yap1 and its target gene, Ccn2 (CTGF), in E7.5 Yap1 cKO and control embryos ( n = 10). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0072 and *** p < 0.0008. ( G ) Graphs display cell cycle S and G2M scores in control and Yap1 cKO embryos from scRNAseq analysis. Box-and-whisker plots indicate the median (center line), interquartile range (25th–75th percentiles; box), and minimum to maximum values (whiskers). Individual dots represent a single cell from E7 embryo scRNA-seq data. ( H ) Bright-field images of control and Yap1 cKO E7 embryos. Graphs show cell number quantification per embryo (left) and the size of the epiblast (right) in control and Yap1 cKO embryos ( n = 8–10 embryos). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test. Scale bar 250 µm. ( I ) Single cell pathway analysis was applied to DEGs. Terms related to TGFb and Wnt signaling pathways significantly enriched (q-value > 1.4, adj. p -value < 0.05) in the epiblast are shown. ( J ) Full western blot of nuclear extracts of E7 embryos shown in Fig. . C: control embryos and Y: Yap1 cKO embryos. Red Arrows indicate bands shown in main Figure; SMAD2/3 (mw: 55 kDa), HISTONE H3 (mw: 15 kDa), GAPDH (mw: 37 kDa), Β-CATENIN (mw: 90 kDa). ( K ) Western blot of whole embryo lysates of E7 control and Yap1 cKO embryos. Pooled embryos numbers are indicated above each lane, along with the makers analyzed and on the right is the full blots. Red Arrows indicate bands that were cropped; SMAD2/3 (mw: 55 kDa), GAPDH (mw: 37 kDa), and Β-CATENIN (mw: 90 kDa).
    Iscript Reverse Transcription Supermix For Rt Qpcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iscript+reverse+transcription+supermix+rt-qpcr/IScript+C+DNA+Synthesis+Kit/pmc13172546-74-0-7
    Average 99 stars, based on 1 article reviews
    iscript reverse transcription supermix for rt qpcr - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    90
    Bio-Rad iscript reverse transcription supermix rt-qpcr
    a DENND5A protein levels in WT, heterozygous (Het), and homozygous knock-in (KI) mouse brains. Results were reproduced in three independent experiments. b DENND5A mRNA levels in n = 6 mouse brains. <t>RT-qPCR</t> was performed in triplicate in three independent experiments. Data are mean ± SEM (two-tailed Mann-Whitney U, Z = −1.81, p = 0.077). c Sample images of in vivo 7 T MRIs. d Quantification of pooled lateral ventricle volumes obtained through segmenting n = 10 MRIs (two-tailed Mann-Whitney U, Z = −2.117, p = 0.034). Each dot represents one animal. e Quantification of relative brain volumes using MRI data from n = 10 mice (two-tailed Mann-Whitney U, Z = −1.361, p = 0.174). Each dot represents one animal. f Quantification of seizure latency after 4-AP injection in n = 5 WT and n = 6 KI mice from three independent experiments (two-tailed student’s t (9) = 3.445, p = 0.007). Each dot represents one animal. Whole-mount in situ hybridization from two independent experiments shows dennd5a mRNA expression at ( g ), 0.75 hpf, ( h ), 24 hpf, ( i ), 48 hpf and ( j ), 72 hpf. Asterisks brain, Ov otic vesicle, Le lens, RGC retinal ganglion cells, Hb hindbrain, H heart, Cm cephalic musculature. Scale bar = 0.2 mm. k Representative images of control and F 0 KO zebrafish from three independent experiments. Dotted line marks the length of the head used in quantification. Scale bar = 0.2 mm. l Quantification of head size in n = 60 larvae (two-tailed Mann-Whitney U, Z = −9.206, p = 3.4 × 10 −20 ). Each dot represents one larva. m Representative image of larva at 6 dpf immunostained with anti-SV2 (magenta) and anti-acetylated tubulin (green). Dorsal view, anterior to the left. Dotted line outlines hindbrain ventricle (HV) area used in quantification. n Quantification of hindbrain ventricle area in n = 6 larvae (two-tailed student’s t (10) = −2.564, p = 0.028). Each dot represents one larva. Source data for ( a , b ), ( d , f ), ( l ) and ( n ) are provided as a file.
    Iscript Reverse Transcription Supermix Rt Qpcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iscript+reverse+transcription+supermix+rt-qpcr/iscript+reverse+transcription+supermix+rt+qpcr/pmc11341845-371-22-23
    Average 90 stars, based on 1 article reviews
    iscript reverse transcription supermix rt-qpcr - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Bio-Rad iscript reverse transcription supermix rt-qpcr kit
    a DENND5A protein levels in WT, heterozygous (Het), and homozygous knock-in (KI) mouse brains. Results were reproduced in three independent experiments. b DENND5A mRNA levels in n = 6 mouse brains. <t>RT-qPCR</t> was performed in triplicate in three independent experiments. Data are mean ± SEM (two-tailed Mann-Whitney U, Z = −1.81, p = 0.077). c Sample images of in vivo 7 T MRIs. d Quantification of pooled lateral ventricle volumes obtained through segmenting n = 10 MRIs (two-tailed Mann-Whitney U, Z = −2.117, p = 0.034). Each dot represents one animal. e Quantification of relative brain volumes using MRI data from n = 10 mice (two-tailed Mann-Whitney U, Z = −1.361, p = 0.174). Each dot represents one animal. f Quantification of seizure latency after 4-AP injection in n = 5 WT and n = 6 KI mice from three independent experiments (two-tailed student’s t (9) = 3.445, p = 0.007). Each dot represents one animal. Whole-mount in situ hybridization from two independent experiments shows dennd5a mRNA expression at ( g ), 0.75 hpf, ( h ), 24 hpf, ( i ), 48 hpf and ( j ), 72 hpf. Asterisks brain, Ov otic vesicle, Le lens, RGC retinal ganglion cells, Hb hindbrain, H heart, Cm cephalic musculature. Scale bar = 0.2 mm. k Representative images of control and F 0 KO zebrafish from three independent experiments. Dotted line marks the length of the head used in quantification. Scale bar = 0.2 mm. l Quantification of head size in n = 60 larvae (two-tailed Mann-Whitney U, Z = −9.206, p = 3.4 × 10 −20 ). Each dot represents one larva. m Representative image of larva at 6 dpf immunostained with anti-SV2 (magenta) and anti-acetylated tubulin (green). Dorsal view, anterior to the left. Dotted line outlines hindbrain ventricle (HV) area used in quantification. n Quantification of hindbrain ventricle area in n = 6 larvae (two-tailed student’s t (10) = −2.564, p = 0.028). Each dot represents one larva. Source data for ( a , b ), ( d , f ), ( l ) and ( n ) are provided as a file.
    Iscript Reverse Transcription Supermix Rt Qpcr Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iscript+reverse+transcription+supermix+rt-qpcr/iscript+reverse+transcription+supermix/pmc11316803-305-19-21
    Average 90 stars, based on 1 article reviews
    iscript reverse transcription supermix rt-qpcr kit - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    ( A ) Gel shows expected bands from flox genotyping using a Yap1Flox:cre system. Adapted from Abraham et al, . ( B ) Gels show the genotype of breeding partners. Note that only males carry the Sox2-cre allele to avoid maternal inheritance of Cre activity. ( C ) Same-day genotyping for flox and Cre for fresh-embryo sequencing was performed from the yolk sacs of 14 embryos, simultaneously isolated from 2 pregnant dams. Four controls, indicated in red triangles, and three Yap1 cKO embryos (floxflox/cre +), shown in blue circles, were pooled and processed for scRNAseq. ( D ) Genotyping of SRY (sex identity) in the 14 embryos isolated for the experimental design of the scRNAseq experiment. ( E ) Violin plot of Yap1 and Wwtr1 (TAZ) from scRNAseq expression levels in all clusters comparing Yap1 cKO to control. Yap1 expression is significantly reduced in Yap1 cKO cells across epiblast lineages, including epiblast (adjusted p = 7.8 × 10⁻⁵⁸), primitive streak (1.2 × 10⁻²⁰), nascent mesoderm (4.2 × 10⁻¹⁷), cardiac mesoderm (1.2 × 10⁻⁵), blood progenitors, and endoderm (3.8 × 10⁻⁴). Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗ p < 0.05, ∗∗ p < 0.001, ∗∗∗ p < 0.0001). Each dot represents a single cell from E7 scRNAseq data. ( F ) Graphs show RT-qPCR analysis of Yap1 and its target gene, Ccn2 (CTGF), in E7.5 Yap1 cKO and control embryos ( n = 10). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0072 and *** p < 0.0008. ( G ) Graphs display cell cycle S and G2M scores in control and Yap1 cKO embryos from scRNAseq analysis. Box-and-whisker plots indicate the median (center line), interquartile range (25th–75th percentiles; box), and minimum to maximum values (whiskers). Individual dots represent a single cell from E7 embryo scRNA-seq data. ( H ) Bright-field images of control and Yap1 cKO E7 embryos. Graphs show cell number quantification per embryo (left) and the size of the epiblast (right) in control and Yap1 cKO embryos ( n = 8–10 embryos). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test. Scale bar 250 µm. ( I ) Single cell pathway analysis was applied to DEGs. Terms related to TGFb and Wnt signaling pathways significantly enriched (q-value > 1.4, adj. p -value < 0.05) in the epiblast are shown. ( J ) Full western blot of nuclear extracts of E7 embryos shown in Fig. . C: control embryos and Y: Yap1 cKO embryos. Red Arrows indicate bands shown in main Figure; SMAD2/3 (mw: 55 kDa), HISTONE H3 (mw: 15 kDa), GAPDH (mw: 37 kDa), Β-CATENIN (mw: 90 kDa). ( K ) Western blot of whole embryo lysates of E7 control and Yap1 cKO embryos. Pooled embryos numbers are indicated above each lane, along with the makers analyzed and on the right is the full blots. Red Arrows indicate bands that were cropped; SMAD2/3 (mw: 55 kDa), GAPDH (mw: 37 kDa), and Β-CATENIN (mw: 90 kDa).

    Journal: EMBO Reports

    Article Title: YAP1 and QSER1 are key modulators of embryonic signaling pathways in the mammalian epiblast

    doi: 10.1038/s44319-026-00746-z

    Figure Lengend Snippet: ( A ) Gel shows expected bands from flox genotyping using a Yap1Flox:cre system. Adapted from Abraham et al, . ( B ) Gels show the genotype of breeding partners. Note that only males carry the Sox2-cre allele to avoid maternal inheritance of Cre activity. ( C ) Same-day genotyping for flox and Cre for fresh-embryo sequencing was performed from the yolk sacs of 14 embryos, simultaneously isolated from 2 pregnant dams. Four controls, indicated in red triangles, and three Yap1 cKO embryos (floxflox/cre +), shown in blue circles, were pooled and processed for scRNAseq. ( D ) Genotyping of SRY (sex identity) in the 14 embryos isolated for the experimental design of the scRNAseq experiment. ( E ) Violin plot of Yap1 and Wwtr1 (TAZ) from scRNAseq expression levels in all clusters comparing Yap1 cKO to control. Yap1 expression is significantly reduced in Yap1 cKO cells across epiblast lineages, including epiblast (adjusted p = 7.8 × 10⁻⁵⁸), primitive streak (1.2 × 10⁻²⁰), nascent mesoderm (4.2 × 10⁻¹⁷), cardiac mesoderm (1.2 × 10⁻⁵), blood progenitors, and endoderm (3.8 × 10⁻⁴). Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗ p < 0.05, ∗∗ p < 0.001, ∗∗∗ p < 0.0001). Each dot represents a single cell from E7 scRNAseq data. ( F ) Graphs show RT-qPCR analysis of Yap1 and its target gene, Ccn2 (CTGF), in E7.5 Yap1 cKO and control embryos ( n = 10). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0072 and *** p < 0.0008. ( G ) Graphs display cell cycle S and G2M scores in control and Yap1 cKO embryos from scRNAseq analysis. Box-and-whisker plots indicate the median (center line), interquartile range (25th–75th percentiles; box), and minimum to maximum values (whiskers). Individual dots represent a single cell from E7 embryo scRNA-seq data. ( H ) Bright-field images of control and Yap1 cKO E7 embryos. Graphs show cell number quantification per embryo (left) and the size of the epiblast (right) in control and Yap1 cKO embryos ( n = 8–10 embryos). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test. Scale bar 250 µm. ( I ) Single cell pathway analysis was applied to DEGs. Terms related to TGFb and Wnt signaling pathways significantly enriched (q-value > 1.4, adj. p -value < 0.05) in the epiblast are shown. ( J ) Full western blot of nuclear extracts of E7 embryos shown in Fig. . C: control embryos and Y: Yap1 cKO embryos. Red Arrows indicate bands shown in main Figure; SMAD2/3 (mw: 55 kDa), HISTONE H3 (mw: 15 kDa), GAPDH (mw: 37 kDa), Β-CATENIN (mw: 90 kDa). ( K ) Western blot of whole embryo lysates of E7 control and Yap1 cKO embryos. Pooled embryos numbers are indicated above each lane, along with the makers analyzed and on the right is the full blots. Red Arrows indicate bands that were cropped; SMAD2/3 (mw: 55 kDa), GAPDH (mw: 37 kDa), and Β-CATENIN (mw: 90 kDa).

    Article Snippet: iScript reverse transcription supermix for RT-qPCR , Biorad , 1708891.

    Techniques: Activity Assay, Sequencing, Isolation, Expressing, Control, Single Cell, Quantitative RT-PCR, Whisker Assay, Protein-Protein interactions, Western Blot

    ( A ) Mice scheme shows the breeding strategy to obtain embryos with conditional deletion of Yap1 in the epiblast (Sox2cre). Blue arrowheads indicate LoxP alleles. E7 heterozygous control (Sox2cre:YAPflox/+) and Yap1 cKO (Sox2cre:Yap1flox/flox) embryos were processed for scRNAseq analysis. Bright-field images show representative embryos of the indicated genotype. The number of embryos processed for sequencing is indicated. Scale bar 250 µm. ( B ) Heatmap showing expression of lineage markers used to annotate cell populations in the E7 scRNAseq datasets. On the right, a schematic of an E7 mouse gastrula and a UMAP of E7 scRNAseq showing the detected cell populations with the number of cells in parentheses, color-coded to match the heatmap. ( C ) Dot plot depicts the number of differentially expressed genes (DEGs) in each cluster, with the exact count indicated to the left of each dot. Note that the epiblast cluster contains the highest number of DEGs (abs(Log2FC)>0.25, adj. p -value < 0.05). ( D ) Heatmap shows DEGs in the epiblast of Yap1 cKO versus control embryos. Relevant genes for pluripotency and differentiation are shown. ( E ) Violin plots shows scRNAseq expression levels of indicated genes across clusters in control and Yap1 cKO. The dotted box highlights the epiblast cluster. Yap1 expression is significantly reduced in Yap1 cKO cells across multiple lineages, including epiblast (adjusted p = 7.8 × 10⁻⁵⁸), primitive streak (1.2 × 10⁻²⁰), nascent mesoderm (4.2 × 10⁻¹⁷), cardiac mesoderm (1.2 × 10⁻⁵), and endoderm (3.8 × 10⁻⁴). Epiblast expression of Nodal (adjusted p = 1.0 × 10⁻⁵), Fgf8 (7.1 × 10⁻⁹), Axin2 (4 × 10⁻ 3 ), and Wnt3 (1.5 × 10⁻⁴) is significantly altered in Yap1 cKO embryos. Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗ p < 0.05, ∗∗ p < 0.001, ∗∗∗ p < 0.0001). Each dot represents a single cell from E7 scRNAseq data. ( F ) Graph shows RT-qPCR analysis of the Nodal gene in E7.5 control and Yap1 cKO embryos ( n = 10). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( G ) Single-cell pathway enrichment analysis (SCPA) was performed on DEGs of Yap1 cKO compared to control. The UMAP plot shows the enrichment of two terms related to the Nodal/TGFb and Wnt pathway. Significant q-values (>1.4) are displayed in orange with the names of populations. The complete list of Wnt and TGFb terms enriched are shown in Fig. . ( H ) Western blot of nuclear extracts of E7 control and Yap1 cKO embryos. The number of embryos pooled per lane is indicated above each lane, along with the markers analyzed. Error bars represent mean ± SD. Uncropped blots are found in Fig. .

    Journal: EMBO Reports

    Article Title: YAP1 and QSER1 are key modulators of embryonic signaling pathways in the mammalian epiblast

    doi: 10.1038/s44319-026-00746-z

    Figure Lengend Snippet: ( A ) Mice scheme shows the breeding strategy to obtain embryos with conditional deletion of Yap1 in the epiblast (Sox2cre). Blue arrowheads indicate LoxP alleles. E7 heterozygous control (Sox2cre:YAPflox/+) and Yap1 cKO (Sox2cre:Yap1flox/flox) embryos were processed for scRNAseq analysis. Bright-field images show representative embryos of the indicated genotype. The number of embryos processed for sequencing is indicated. Scale bar 250 µm. ( B ) Heatmap showing expression of lineage markers used to annotate cell populations in the E7 scRNAseq datasets. On the right, a schematic of an E7 mouse gastrula and a UMAP of E7 scRNAseq showing the detected cell populations with the number of cells in parentheses, color-coded to match the heatmap. ( C ) Dot plot depicts the number of differentially expressed genes (DEGs) in each cluster, with the exact count indicated to the left of each dot. Note that the epiblast cluster contains the highest number of DEGs (abs(Log2FC)>0.25, adj. p -value < 0.05). ( D ) Heatmap shows DEGs in the epiblast of Yap1 cKO versus control embryos. Relevant genes for pluripotency and differentiation are shown. ( E ) Violin plots shows scRNAseq expression levels of indicated genes across clusters in control and Yap1 cKO. The dotted box highlights the epiblast cluster. Yap1 expression is significantly reduced in Yap1 cKO cells across multiple lineages, including epiblast (adjusted p = 7.8 × 10⁻⁵⁸), primitive streak (1.2 × 10⁻²⁰), nascent mesoderm (4.2 × 10⁻¹⁷), cardiac mesoderm (1.2 × 10⁻⁵), and endoderm (3.8 × 10⁻⁴). Epiblast expression of Nodal (adjusted p = 1.0 × 10⁻⁵), Fgf8 (7.1 × 10⁻⁹), Axin2 (4 × 10⁻ 3 ), and Wnt3 (1.5 × 10⁻⁴) is significantly altered in Yap1 cKO embryos. Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗ p < 0.05, ∗∗ p < 0.001, ∗∗∗ p < 0.0001). Each dot represents a single cell from E7 scRNAseq data. ( F ) Graph shows RT-qPCR analysis of the Nodal gene in E7.5 control and Yap1 cKO embryos ( n = 10). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( G ) Single-cell pathway enrichment analysis (SCPA) was performed on DEGs of Yap1 cKO compared to control. The UMAP plot shows the enrichment of two terms related to the Nodal/TGFb and Wnt pathway. Significant q-values (>1.4) are displayed in orange with the names of populations. The complete list of Wnt and TGFb terms enriched are shown in Fig. . ( H ) Western blot of nuclear extracts of E7 control and Yap1 cKO embryos. The number of embryos pooled per lane is indicated above each lane, along with the markers analyzed. Error bars represent mean ± SD. Uncropped blots are found in Fig. .

    Article Snippet: iScript reverse transcription supermix for RT-qPCR , Biorad , 1708891.

    Techniques: Control, Sequencing, Expressing, Single Cell, Quantitative RT-PCR, Western Blot

    ( A ) Bar graph showing the percentage of embryonic cell populations detected by scRNA-seq analysis in control and Yap1 cKO embryos. Statistical significance was assessed using the Chi-square test (* p < 0.05). Only embryonic populations are shown. See Fig. for analysis including all populations. ( B ) Representative images of whole-mount immunostaining for the PS marker BRACHYURY (T/BRA) (green) in E7.5 control and Yap1 cKO embryos. DAPI (blue) marks nuclei. On the right, a scheme summarizing results; compared to controls, Yap1 cKO embryos have expanded the PS domain. Scale bar 250 µm Pr: proximal, A: anterior, P: posterior, D: Distal. ( C ) Graphs show quantifications of T/BRA signal intensity along the proximal to distal axis of the embryo (left), the posterior to anterior axis (middle), and the overall intensity of the immunostaining (right). An in-house developed Matlab script was applied to quantify fluorescence. The experiment was replicated with three separate litters ( n = 3). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( D ) RT-qPCR of T/Bra in E7.5 control and Yap1 cKO embryos ( n = 10). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, ∗∗ p = 0.0097.

    Journal: EMBO Reports

    Article Title: YAP1 and QSER1 are key modulators of embryonic signaling pathways in the mammalian epiblast

    doi: 10.1038/s44319-026-00746-z

    Figure Lengend Snippet: ( A ) Bar graph showing the percentage of embryonic cell populations detected by scRNA-seq analysis in control and Yap1 cKO embryos. Statistical significance was assessed using the Chi-square test (* p < 0.05). Only embryonic populations are shown. See Fig. for analysis including all populations. ( B ) Representative images of whole-mount immunostaining for the PS marker BRACHYURY (T/BRA) (green) in E7.5 control and Yap1 cKO embryos. DAPI (blue) marks nuclei. On the right, a scheme summarizing results; compared to controls, Yap1 cKO embryos have expanded the PS domain. Scale bar 250 µm Pr: proximal, A: anterior, P: posterior, D: Distal. ( C ) Graphs show quantifications of T/BRA signal intensity along the proximal to distal axis of the embryo (left), the posterior to anterior axis (middle), and the overall intensity of the immunostaining (right). An in-house developed Matlab script was applied to quantify fluorescence. The experiment was replicated with three separate litters ( n = 3). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( D ) RT-qPCR of T/Bra in E7.5 control and Yap1 cKO embryos ( n = 10). Data are presented as mean ± SEM. Statistical analysis: Student’s t-test, ∗∗ p = 0.0097.

    Article Snippet: iScript reverse transcription supermix for RT-qPCR , Biorad , 1708891.

    Techniques: Control, Immunostaining, Marker, Fluorescence, Quantitative RT-PCR

    ( A ) Graph shows QSER1 mRNA levels in hESCs transfected with siRNA control and siRNA against QSER1 for 72 h ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, *** p = 0.001. ( B ) Western blot of QSER1 protein levels, same conditions as in ( A ). ( C ) Graphs show ChIP-qPCR analysis of RNA polymerase II protein on the indicated genomic regions in sicontrol and siQSER1 hESCs. QSER1 BS: QSER1 binding site NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0051 (NODAL), ** p = 0.0031 (CDX2), * p = 0.0116 (OTX2), * p = 0.0343 (SOX13), ** p = 0.0011 (SHB), and ** p = 0.0037 (SMAD2). ( D ) H1 hESCs were transfected with control or QSER1 siRNAs and left untreated or treated with Activin (=mesoderm inductor) for 24 h. Graphs show RT-qPCR analysis of NODAL and WNT3 genes ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, Nodal (* p = 0.0117, ** p = 0.0098, **** p < 0.001) and Wnt (* p = 0.0154, ** p = 0.0012, *** p = 0.0003). ( E ) Representative images of hESCs treated with Activin (50 ng/mL) for 48 h and immunostained for BRACHYURY (BRA). The experimental groups are indicated; sicontrol (scramble siRNA), siQSER1 (siRNA against QSER1) or a YAP1 inhibitor (0.5 µM Dasatinib; YAP1i) were used. Scale bar, 50 µm. ( F ) Graph shows quantification of BRACHYURY immunostaining signal across the indicated experimental groups (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: One-way ANOVA, **** p < 0.0001. ( G ) NODAL protein expression was visualized (live imaging) using an engineered dual-reporter line expressing NODAL-citrine and H2B-RFP (Liu et al, ). H2B-RFP is shown as control. Experimental groups are indicated. BF, bright field. Scale bar, 125 µm. ( H ) Graph shows quantification of intensity of citrine-Nodal levels (cNODAL) per cell (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( I ) UMAP from scRNAseq datasets of E7 embryos showing Qser1 mRNA expression in control and cYap1 KO embryos. Dotted circles highlight the epiblast cluster (see Fig. ). Differential Qser1 expression in the epiblast of Yap1 cKO versus control embryos is indicated (adj. p = 1.93e-07). ( J ) Violin plot of Qser1 from scRNAseq of E7 embryos showing expression levels in all clusters Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗∗∗ p = 1.9e-07). Each dot represents a single cell from E7 scRNAseq data. ( K ) WT H1 hESCs were differentiated toward ectoderm (ecto), mesoderm (meso), or endoderm (endo) fates followed by RNAseq analysis (Stronati et al, ). Graph shows the expression of QSER1 from these datasets in the indicated conditions ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0004 and *** p < 0.001, ** p < 0.01). ( L ) Cooperative mechanism of YAP1 and QSER1 modulating gene expression of signaling genes in the mammalian epiblast. Two developmental stages are shown. QSER1 expression decreases as the epiblast transitions to PS, which allows RNAPII recruitment and increased transcription of genes, including Nodal . PS: primitive streak. Pr: proximal, A: anterior, P: posterior, D: Distal.

    Journal: EMBO Reports

    Article Title: YAP1 and QSER1 are key modulators of embryonic signaling pathways in the mammalian epiblast

    doi: 10.1038/s44319-026-00746-z

    Figure Lengend Snippet: ( A ) Graph shows QSER1 mRNA levels in hESCs transfected with siRNA control and siRNA against QSER1 for 72 h ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, *** p = 0.001. ( B ) Western blot of QSER1 protein levels, same conditions as in ( A ). ( C ) Graphs show ChIP-qPCR analysis of RNA polymerase II protein on the indicated genomic regions in sicontrol and siQSER1 hESCs. QSER1 BS: QSER1 binding site NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0051 (NODAL), ** p = 0.0031 (CDX2), * p = 0.0116 (OTX2), * p = 0.0343 (SOX13), ** p = 0.0011 (SHB), and ** p = 0.0037 (SMAD2). ( D ) H1 hESCs were transfected with control or QSER1 siRNAs and left untreated or treated with Activin (=mesoderm inductor) for 24 h. Graphs show RT-qPCR analysis of NODAL and WNT3 genes ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, Nodal (* p = 0.0117, ** p = 0.0098, **** p < 0.001) and Wnt (* p = 0.0154, ** p = 0.0012, *** p = 0.0003). ( E ) Representative images of hESCs treated with Activin (50 ng/mL) for 48 h and immunostained for BRACHYURY (BRA). The experimental groups are indicated; sicontrol (scramble siRNA), siQSER1 (siRNA against QSER1) or a YAP1 inhibitor (0.5 µM Dasatinib; YAP1i) were used. Scale bar, 50 µm. ( F ) Graph shows quantification of BRACHYURY immunostaining signal across the indicated experimental groups (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: One-way ANOVA, **** p < 0.0001. ( G ) NODAL protein expression was visualized (live imaging) using an engineered dual-reporter line expressing NODAL-citrine and H2B-RFP (Liu et al, ). H2B-RFP is shown as control. Experimental groups are indicated. BF, bright field. Scale bar, 125 µm. ( H ) Graph shows quantification of intensity of citrine-Nodal levels (cNODAL) per cell (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0001. ( I ) UMAP from scRNAseq datasets of E7 embryos showing Qser1 mRNA expression in control and cYap1 KO embryos. Dotted circles highlight the epiblast cluster (see Fig. ). Differential Qser1 expression in the epiblast of Yap1 cKO versus control embryos is indicated (adj. p = 1.93e-07). ( J ) Violin plot of Qser1 from scRNAseq of E7 embryos showing expression levels in all clusters Adjusted p -values were calculated using a Wilcoxon rank-sum test with Benjamini–Hochberg correction (∗∗∗ p = 1.9e-07). Each dot represents a single cell from E7 scRNAseq data. ( K ) WT H1 hESCs were differentiated toward ectoderm (ecto), mesoderm (meso), or endoderm (endo) fates followed by RNAseq analysis (Stronati et al, ). Graph shows the expression of QSER1 from these datasets in the indicated conditions ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0004 and *** p < 0.001, ** p < 0.01). ( L ) Cooperative mechanism of YAP1 and QSER1 modulating gene expression of signaling genes in the mammalian epiblast. Two developmental stages are shown. QSER1 expression decreases as the epiblast transitions to PS, which allows RNAPII recruitment and increased transcription of genes, including Nodal . PS: primitive streak. Pr: proximal, A: anterior, P: posterior, D: Distal.

    Article Snippet: iScript reverse transcription supermix for RT-qPCR , Biorad , 1708891.

    Techniques: Transfection, Control, Western Blot, ChIP-qPCR, Binding Assay, Negative Control, Quantitative RT-PCR, Immunostaining, Expressing, Imaging, Single Cell, RNA sequencing, Gene Expression

    ( A ) IGV genome browser snapshots show more examples of distribution of QSER1, YAP1, TEAD4, and NIPBL on indicated genes. ( B ) Graphs show ChIP-qPCR analysis of QSER1 protein on the indicated genomic regions in WT and YAP1 KO hESCs. QSER1 BS: QSER1 binding site. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( C ) Graphs show ChIP-qPCR analysis of YAP1 protein on the indicated genomic regions and conditions in sicontrol and siQSER1 conditions. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( D ) RT-qPCR of gene expression of CTGF (downstream gene of the Hippo signaling pathway) and NODAL in WT H1 hESCs treated with or without 5 µM GNE-7883 TEAD inhibitor (TEADi) ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0056 (CTGF) and ** p = 0.0059 (NODAL). ( E ) Graph of ChIP-qPCR of TEAD4, YAP1, and QSER1 at enhancer of the NODAL gene in untreated and TEADi treated cells. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, * p = 0.0148, ** p = 0.0064 (YAP1), and ** p = 0.0066 (TEAD4). ( F ) Molecular modeling of TEAD4 (blue), YAP1 (orange), and QSER1 (green) using AlphaFold3 showing that YAP1 residues 50–60 are tightly bound to QSER1 residues 1613–1623 (7 hydrogen bonds) and TEAD4 residues 340–349 (5 hydrogen bonds, shown as dotted lines). Top ipTM scores for this complex are 0.68, reflecting a high confidence in the conformation of this model.

    Journal: EMBO Reports

    Article Title: YAP1 and QSER1 are key modulators of embryonic signaling pathways in the mammalian epiblast

    doi: 10.1038/s44319-026-00746-z

    Figure Lengend Snippet: ( A ) IGV genome browser snapshots show more examples of distribution of QSER1, YAP1, TEAD4, and NIPBL on indicated genes. ( B ) Graphs show ChIP-qPCR analysis of QSER1 protein on the indicated genomic regions in WT and YAP1 KO hESCs. QSER1 BS: QSER1 binding site. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( C ) Graphs show ChIP-qPCR analysis of YAP1 protein on the indicated genomic regions and conditions in sicontrol and siQSER1 conditions. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( D ) RT-qPCR of gene expression of CTGF (downstream gene of the Hippo signaling pathway) and NODAL in WT H1 hESCs treated with or without 5 µM GNE-7883 TEAD inhibitor (TEADi) ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, ** p = 0.0056 (CTGF) and ** p = 0.0059 (NODAL). ( E ) Graph of ChIP-qPCR of TEAD4, YAP1, and QSER1 at enhancer of the NODAL gene in untreated and TEADi treated cells. NegC: Negative control region ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, * p = 0.0148, ** p = 0.0064 (YAP1), and ** p = 0.0066 (TEAD4). ( F ) Molecular modeling of TEAD4 (blue), YAP1 (orange), and QSER1 (green) using AlphaFold3 showing that YAP1 residues 50–60 are tightly bound to QSER1 residues 1613–1623 (7 hydrogen bonds) and TEAD4 residues 340–349 (5 hydrogen bonds, shown as dotted lines). Top ipTM scores for this complex are 0.68, reflecting a high confidence in the conformation of this model.

    Article Snippet: iScript reverse transcription supermix for RT-qPCR , Biorad , 1708891.

    Techniques: ChIP-qPCR, Binding Assay, Negative Control, Quantitative RT-PCR, Gene Expression

    ( A ) Full uncropped blot of Fig. . Blotted against QSER1 (mw: 190 kDa) and beta-TUBLIN (mw: 50 kDa). Red arrow indicates the band that was cropped. Sic: sicontrol and SiQ: siQSER1. ( B ) Graphs show ChIP-qPCR analysis of RNA polymerase II protein on the indicated genomic regions in sicontrol and siQSER1 hESCs. NegC: Negative control region and QSER1 BS: QSER1 binding site ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( C ) Additional images of hESC treated with Activin and stained for BRA shown in Fig. . ( D ) Graphs show RT-qPCR analysis of YAP1-target genes CTGF and CYR61 in hESCs untreated and treated with the YAP1 inhibitor (YAPi) DASATINIB for 72 h treatment ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, CTGF: * p = 0.0367 and CYR61: * p = 0.0490. ( E ) Scheme of the Nodal-citrine: H2B-RFP hESC construct with representative fluorescent images of hESCs under basal conditions. ( F ) Additional images of hESC treated with Activin and NODAL shown in Fig. . ( G ) Representative images of untreated and YAP1i treated hESCs treated with Activin (50 ng/mL) for 48 h, NODAL protein expression was visualized using an engineered dual-reporter line expressing NODAL-citrine and H2B-RFP (Liu et al, ). Scale bar, 125 µm. Graph shows quantification of fluorescence intensity per cell (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0004.

    Journal: EMBO Reports

    Article Title: YAP1 and QSER1 are key modulators of embryonic signaling pathways in the mammalian epiblast

    doi: 10.1038/s44319-026-00746-z

    Figure Lengend Snippet: ( A ) Full uncropped blot of Fig. . Blotted against QSER1 (mw: 190 kDa) and beta-TUBLIN (mw: 50 kDa). Red arrow indicates the band that was cropped. Sic: sicontrol and SiQ: siQSER1. ( B ) Graphs show ChIP-qPCR analysis of RNA polymerase II protein on the indicated genomic regions in sicontrol and siQSER1 hESCs. NegC: Negative control region and QSER1 BS: QSER1 binding site ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test. ( C ) Additional images of hESC treated with Activin and stained for BRA shown in Fig. . ( D ) Graphs show RT-qPCR analysis of YAP1-target genes CTGF and CYR61 in hESCs untreated and treated with the YAP1 inhibitor (YAPi) DASATINIB for 72 h treatment ( n = 3, independent biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, CTGF: * p = 0.0367 and CYR61: * p = 0.0490. ( E ) Scheme of the Nodal-citrine: H2B-RFP hESC construct with representative fluorescent images of hESCs under basal conditions. ( F ) Additional images of hESC treated with Activin and NODAL shown in Fig. . ( G ) Representative images of untreated and YAP1i treated hESCs treated with Activin (50 ng/mL) for 48 h, NODAL protein expression was visualized using an engineered dual-reporter line expressing NODAL-citrine and H2B-RFP (Liu et al, ). Scale bar, 125 µm. Graph shows quantification of fluorescence intensity per cell (50 cells were quantified from three biological replicates). Data presented as mean ± SEM. Statistical analysis: Student’s t-test, **** p < 0.0004.

    Article Snippet: iScript reverse transcription supermix for RT-qPCR , Biorad , 1708891.

    Techniques: ChIP-qPCR, Negative Control, Binding Assay, Staining, Quantitative RT-PCR, Construct, Expressing, Fluorescence

    a DENND5A protein levels in WT, heterozygous (Het), and homozygous knock-in (KI) mouse brains. Results were reproduced in three independent experiments. b DENND5A mRNA levels in n = 6 mouse brains. RT-qPCR was performed in triplicate in three independent experiments. Data are mean ± SEM (two-tailed Mann-Whitney U, Z = −1.81, p = 0.077). c Sample images of in vivo 7 T MRIs. d Quantification of pooled lateral ventricle volumes obtained through segmenting n = 10 MRIs (two-tailed Mann-Whitney U, Z = −2.117, p = 0.034). Each dot represents one animal. e Quantification of relative brain volumes using MRI data from n = 10 mice (two-tailed Mann-Whitney U, Z = −1.361, p = 0.174). Each dot represents one animal. f Quantification of seizure latency after 4-AP injection in n = 5 WT and n = 6 KI mice from three independent experiments (two-tailed student’s t (9) = 3.445, p = 0.007). Each dot represents one animal. Whole-mount in situ hybridization from two independent experiments shows dennd5a mRNA expression at ( g ), 0.75 hpf, ( h ), 24 hpf, ( i ), 48 hpf and ( j ), 72 hpf. Asterisks brain, Ov otic vesicle, Le lens, RGC retinal ganglion cells, Hb hindbrain, H heart, Cm cephalic musculature. Scale bar = 0.2 mm. k Representative images of control and F 0 KO zebrafish from three independent experiments. Dotted line marks the length of the head used in quantification. Scale bar = 0.2 mm. l Quantification of head size in n = 60 larvae (two-tailed Mann-Whitney U, Z = −9.206, p = 3.4 × 10 −20 ). Each dot represents one larva. m Representative image of larva at 6 dpf immunostained with anti-SV2 (magenta) and anti-acetylated tubulin (green). Dorsal view, anterior to the left. Dotted line outlines hindbrain ventricle (HV) area used in quantification. n Quantification of hindbrain ventricle area in n = 6 larvae (two-tailed student’s t (10) = −2.564, p = 0.028). Each dot represents one larva. Source data for ( a , b ), ( d , f ), ( l ) and ( n ) are provided as a file.

    Journal: Nature Communications

    Article Title: Loss of symmetric cell division of apical neural progenitors drives DENND5A -related developmental and epileptic encephalopathy

    doi: 10.1038/s41467-024-51310-z

    Figure Lengend Snippet: a DENND5A protein levels in WT, heterozygous (Het), and homozygous knock-in (KI) mouse brains. Results were reproduced in three independent experiments. b DENND5A mRNA levels in n = 6 mouse brains. RT-qPCR was performed in triplicate in three independent experiments. Data are mean ± SEM (two-tailed Mann-Whitney U, Z = −1.81, p = 0.077). c Sample images of in vivo 7 T MRIs. d Quantification of pooled lateral ventricle volumes obtained through segmenting n = 10 MRIs (two-tailed Mann-Whitney U, Z = −2.117, p = 0.034). Each dot represents one animal. e Quantification of relative brain volumes using MRI data from n = 10 mice (two-tailed Mann-Whitney U, Z = −1.361, p = 0.174). Each dot represents one animal. f Quantification of seizure latency after 4-AP injection in n = 5 WT and n = 6 KI mice from three independent experiments (two-tailed student’s t (9) = 3.445, p = 0.007). Each dot represents one animal. Whole-mount in situ hybridization from two independent experiments shows dennd5a mRNA expression at ( g ), 0.75 hpf, ( h ), 24 hpf, ( i ), 48 hpf and ( j ), 72 hpf. Asterisks brain, Ov otic vesicle, Le lens, RGC retinal ganglion cells, Hb hindbrain, H heart, Cm cephalic musculature. Scale bar = 0.2 mm. k Representative images of control and F 0 KO zebrafish from three independent experiments. Dotted line marks the length of the head used in quantification. Scale bar = 0.2 mm. l Quantification of head size in n = 60 larvae (two-tailed Mann-Whitney U, Z = −9.206, p = 3.4 × 10 −20 ). Each dot represents one larva. m Representative image of larva at 6 dpf immunostained with anti-SV2 (magenta) and anti-acetylated tubulin (green). Dorsal view, anterior to the left. Dotted line outlines hindbrain ventricle (HV) area used in quantification. n Quantification of hindbrain ventricle area in n = 6 larvae (two-tailed student’s t (10) = −2.564, p = 0.028). Each dot represents one larva. Source data for ( a , b ), ( d , f ), ( l ) and ( n ) are provided as a file.

    Article Snippet: RNA was extracted from NPCs and lymphocytes using the RNeasy kit (Qiagen) followed by cDNA synthesis using iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad).

    Techniques: Knock-In, Quantitative RT-PCR, Two Tailed Test, MANN-WHITNEY, In Vivo, Injection, In Situ Hybridization, Expressing, Control